Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-378b precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-378b precursor URS000075E326_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR378B: MIR378B is a microRNA that has been implicated in various cellular processes. It has been shown that circ_0078710 enhances the expression of PRIM2 by sponging MIR378B, and the downregulation of circ_0078710 leads to an increase in MIR378B population, resulting in the downregulation of PRIM2, which is involved in cell proliferation [PMC9774417]. MIR378B has also been found to target Usp22, which is involved in the maintenance of neural stem/progenitor cells [PMC7041117]. In a study that functionally annotated miRNAs, MIR378B was identified as one of the miRNAs involved [PMC6349826]. Another study found that ANIT downregulated MIR378B in rat liver [PMC6349826]. Additionally, MIR378B was found to be upregulated in KSHV (+) tumors and was associated with miR143-3p [PMC8242244]. In a comparison between striatum and cortex tissues, MIR378B was one of the microRNAs that showed significant association with Q values [PMC5764268]. Furthermore, it was observed that MIR378B expression was elevated in CpG-stimulated DCs with miR-378b inhibition but showed no change with miR-378 overexpression [PMC6963666]. In summary, MIR378B is a microRNA that plays a role in cell proliferation and neural stem/progenitor cell maintenance. It has been implicated in various cellular processes and its expression can be regulated by different factors.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUCAUUGAGUCUUCAAGGCUAGUGGAAAGAGCACUGGACUUGGAGGCAGAAAGACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

2D structure Publications