v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) FOXN3 antisense RNA 1 (FOXN3-AS1) URS000075E2C1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

FOXN3-AS1: FOXN3-AS1 is a highly regulated non-coding gene with unknown function [PMC6129005]. In breast cancer, FOXN3-AS1 was found to be up-regulated in tumor samples compared to normal adjacent tissues and was associated with tumor size and tumor stages [PMC8526775]. Dysregulation of FOXN3-AS1 has also been identified in non-small-cell lung carcinoma (NSCLC) [PMC8526775]. However, the exact role of FOXN3-AS1 in tumorigenesis is still unclear and requires further functional investigations [PMC8526775]. In addition to breast cancer and NSCLC, no other significant associations have been reported between FOXN3-AS1 expression levels and other characteristics or diseases mentioned in the context [PMC8526775]. Overall, FOXN3-AS1 is an lncRNA that has been implicated in glioma and breast cancer but requires further research to fully understand its function and potential as a diagnostic biomarker [PMC6129005][PMC8526775].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGGGCACUGACCCGCCGGGGCGGACCCUGCCCGCGCCCCUCGCGCGCCCCAGCACUCAGCCAGGGCGGAGGCCGGGGCUGGGCCGCGCGGCCUCGCCUCUUGGGCCCCGCGGGGCGGGGGUGACCGGCGCGGGUCCCGCGACCCAGGGCGGCCGCGACCGUGGGCGGUGGGGCAGGUGGGUCAGGCGGCGCGUGCCCUGUCCCCUCCCCGGGCUCCGGCCACACGAGCGGGCCGGCGCUGCGCUGCUGGCAACGUGUCGCGGGAACGCUCCUACCCCAUCUGCAUGCCUUACAUGGCUCGAAAGUAAAAAUAAAAAGAAUUACGAUGCGGGCGAGGCUUGUGGGGGUGAGAAGAGGAGAUUCCACGUCUCCCCAGUGCUGCGUCCUGAUAGGACCCCCAGGGCCUUCCGAGCCCUCUCCCAGCGACCACCUCGUGUCCCGGAGUUGCAGCAAGAGAUGUGAGAAGGUGUCACCCUGAAGAGGAAGUGGUGGACCAGCCCUGCCUGAUGUGGACAGCAGGGGACACAUGUCUGCCUGUCGGUCUAUCUGAAAUGGGGGAAAAAAUGCUGAAAGCCAAAGGAGGGCUUAAUGUGGCCUUUUCCACCUUCUAAUUCCAUAGAACCUCAGCUCUGGGACUUGCUUCCUGACCUAGGGUGCAGGGGCCAAAUUUGUUUGGGAACAACCCCAUUCACAAUUCCCCAUGAACUUUCAGAAAGGACCCUUGCGUCUUAGGUCCUGAGAAGUCACAAAUAAGCAAGCUGCAUUGUCUAAUGUCUUGUCUACACUGUUUUACAAACACAUUUAACAGCCGAAUUGUAUAUGUGCCCUAGAAAUCACUUUGAGAAACACUUAUUUCCUGAUAGAGGACUUGAUGGGACCAUUCUGCAGCCCCAUCUGAGCAUGGGCUGGAGAGUACAUAAGUAUCUGGGAGCUGGAAGUCCUCAAUUCCAGGCUUAUCUGCCCCCAUCAGCGUGGGACCUCAGUUCCUCCUCCAAGGAGAAGAGCGCCCCUCCCUUGAUGUUUUGUGCAUUCUUUUGCUAAAUGUUUCUCUGGUCAAGAACUUUAAUCCCCCUACACAAAAAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications