v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-500a precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-500a precursor URS000075E243_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR500A: MIR500A is a microRNA that has been studied in the context of drug treatment in SAOS 2 cells. Treatment with certain drugs led to an increase in MIR500A promoter activity, as shown in Figure [PMC8253104]. However, the expression of MIR500A was not affected when parental SAOS 2 cells were treated with these drugs, ruling out any off-target effects [PMC8253104].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCUCCCCCUCUCUAAUCCUUGCUACCUGGGUGAGAGUGCUGUCUGAAUGCAAUGCACCUGGGCAAGGAUUCUGAGAGCGAGAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Aotus nancymaae miRNA (ENSANAG00000013377.1)
  2. Callithrix jacchus miRNA (ENSCJAG00000027735.3)
  3. Cebus imitator microRNA 500a (ENSCCAG00000007591.1)
  4. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000017611.1)
  5. Chlorocebus sabaeus (African green monkey) microRNA 500a (ENSCSAG00000024832.1)
  6. Colobus angolensis palliatus miRNA (ENSCANG00000004502.1)
  7. Gorilla gorilla gorilla microRNA 500a (ENSGGOG00000038948.1)
  8. Macaca fascicularis (Crab-eating macaque) microRNA 500a (ENSMFAG00000013726.2)
  9. Mandrillus leucophaeus miRNA (ENSMLEG00000009923.1)
  10. Nomascus leucogenys microRNA 500a (ENSNLEG00000027385.1)
  11. Papio anubis (olive baboon) miRNA (ENSPANG00000048303.1)
  12. Piliocolobus tephrosceles miRNA (ENSPTEG00000030594.1)
  13. Pongo abelii microRNA 500a (ENSPPYG00000021311.2)
  14. Pongo pygmaeus microRNA ppy-mir-500 precursor
  15. Rhinopithecus bieti miRNA (ENSRBIG00000010452.1)
  16. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000005960.1)
  17. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000016474.1)
  18. Theropithecus gelada (gelada) microRNA 500a (ENSTGEG00000001628.1)
 2D structure Publications