Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Zea mays (maize) zma-miR399b-5p URS000075E239_4577

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

zma-miR399b-5p: Zma-mir399b-5p is a member of the miR399 family of microRNAs [PMC6214007]. Decreased expression of several miRNAs, including zma-mir399b-5p, leads to an increase in the expression of genes involved in the fatty acid biosynthetic process, promoting fatty acid metabolism and lipid delivery from plants to arbuscular mycorrhizal (AM) fungi [PMC9499406]. In a study, zma-mir399b-5p was found to be down-regulated [PMC6214007]. Along with zma-miR399h-5p and zma-miR397b-5p, zma-mir399b-5p is believed to control the expression of genes involved in fatty acid metabolism and/or transportation [PMC6214007]. Specifically, Zm00001d003797, a root r-b1-like gene, was found to be regulated by zma-miR399d-5p, zma-mir399b-5p, and zma-miR399h-5p [PMC6214007]. In another study, three different differentially expressed long non-coding RNAs (DELs) were found to adsorb miRNAs including zma-mir399b-5p [PMC8756644]. These findings suggest that zma-mir399b-5p plays a role in regulating genes involved in fatty acid metabolism and transportation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGCAGCUCUCCUCUGGCAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications