Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-345 precursor URS000075E1CD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR345: MIR345 is a methylation-sensitive microRNA (miRNA) that is involved in cell proliferation and invasion in colorectal cancer [PMC3383700]. It has been found to be differentially expressed in pancreatic cancer tissues, suggesting its potential as a therapeutic target for pancreatic malignancy [PMC7457762]. MIR345 has also been identified as one of the miRNAs expressed at low levels in tumor tissues or cells [PMC7797122]. Additionally, its expression has been reported to reduce dose-dependently in the model of endothelial injury induced by oxLDL [PMC9199460]. The aberrant expression of MIR345, along with other miRNAs such as let-7, miR-34, and miR-342, is regulated by DNA methylation and is associated with the development of colorectal cancer [PMC9141994] [PMC8910953]. In the context of gastric cancer (GC), MIR345 has been identified as one of the factors related to survival [PMC5856436]. Furthermore, MIR345 has been identified as a metastasis-suppressive gene in colorectal cancer along with other protein-coding genes and microRNAs [PMC8484294]. In leukoplakia and invasive oral squamous cell carcinoma (OSCC), overexpression of MIR345 has been associated with increases in lesion severity during progression, suggesting its potential role in malignant transformation [PMC3292026] [PMC5596676]. Overall, MIR345 is a methylation-sensitive miRNA that plays important roles in various cancers and may serve as a potential therapeutic target or prognostic marker.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCCAAACCCUAGGUCUGCUGACUCCUAGUCCAGGGCUCGUGAUGGCUGGUGGGCCCUGAACGAGGGGUCUGGAGGCCUGGGUUUGAAUAUCGACAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications