Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1237 (LINC01237) URS000075E1A2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01237: LINC01237 is a noncoding RNA, specifically a Long Intergenic Non-Protein Coding RNA [PMC7376060]. Its exact function is still unknown [PMC7376060]. In a study on antipsychotic-specific analyses, LINC01237 was found to be associated with QTc change to ziprasidone [PMC8825824]. Another study identified LINC01237 as one of the 56 differentially expressed prognosis-associated lncRNAs [PMC8883231]. The expression level of LINC01237 was found to be correlated with the expression levels of immune checkpoints CTLA-4, PD-1, and PD-L1 [PMC8883231]. In genetic association studies, PDCD1 rs7421861 was found to be associated with an altered intron excision ratio for LINC01238 in splenic tissue, and PDCD1 rs10204525 was associated with an altered intron excision ratio for LINC01237 in whole blood [PMC8003582]. In a gene list intersection analysis, LINC01237 was one of the five lncRNAs identified along with EIF1AX-AS1, LINC00115, MALAT1 and LINC00528. Among these five lncRNAs, only LINC00115 and MALAT1 have been experimentally validated to correlate with cancers according to the lncRNADisease2.0 database [PMC7880362].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUCCUUUUUCUCUGUGCAUCCUCAGUGACGCGGGGCACAGCUCUGCCCGGGGGCCUACCAGAGCCCACCUGGACCCCACACUGGGUCAGCCCUGGUGCGGAGGAGGCCGCUGUAGGCGCGGCCAGGUCACAGUCGGCACCAGAAGUUUGGCAGAUCUCAGUGAGGCGUUAGUUUGCAUUUCCUUGUGACGGGUUUUGACUGGAAUGCCAGGCUUAACGUUGCUCAGAAGUUGCUUCUAUGAGGACGUCUCCCAGCAGCUGUCAGUGUUUCCAAUGAGUCAUCGCCAGCCCCUGCAAUGAGCCUCUCAGGCUGGAACAGUACAACAUGAGGAAGCAGAAUCAAUGCACAGAAAUUAAGCUAAUGUCUUCAGUCUUUGCAACACCACUUGAGCAGCUUGACCAAGUCACUCAUGCCUAGUGGCCCCGUUAGUUGCUCUUCUCCCAUCAAUGAGCUUUGGAAUUUUCGUCAGUAGCUGCCUAUGCAUUACUCAUGGAUCAGAGAGCAGAAAGAAACCAGACAUUGCCAAGUCCCACCUAGGUAGCUACACAGGGAGCCCUGUAUUGACCAUGGCCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications