Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1234-3p URS000075E194_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1234: Hsa-mir-1234 is a miRNA gene that is not included in the hg19 genome, but it has been identified in various studies. In a study analyzing miRNA genes, it was found that the hg19 genome does not include regions covering hsa-mir-1234 [PMC7648123]. In another study comparing kidney tissues of healthy individuals with kidney tissue samples of DN patients, hsa-mir-1234 was identified as one of the differentially expressed miRNAs [PMC8616647]. Hsa-mir-1234 has also been mentioned in studies discussing the difference between mature miRNA and ncRNA [PMC3495686]. It has been computationally identified as a SID producing mirtron [PMC5416886]. The hsa-mir-1234 loop has been analyzed and found to have a G-rich sequence but did not show high binding intensities to rG4-binding proteins [PMC7723054]. Hsa-mir-1234 has also been mentioned in studies related to NPC and its diagnostic power [PMC9318750]. It was found that hsa-mir-1234 added prognostic value to the stage system of TNM in NPC patients [PMC9318750]. However, it was observed that hsa-mir-1234 could not be enriched by the circPOFUT1 probe in another study [PMC9829716]. Additionally, there is an inverse correlation between MMP9 and hsa-mir-1234 in MFS patients [PMC5848586].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGGCCUGACCACCCACCCCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Macaca mulatta mml-miR-1234
  2. Pan troglodytes ptr-miR-1234
Publications