Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) microRNA mmu-mir-140 precursor URS000075E179_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-140: Mmu-mir-140 is a microRNA that has been found to suppress IL-6 translation by binding to the 3′UTR of IL-6 mRNA, potentially mediating the function of Rb in suppressing tumor progression [PMC5355146]. In a study, 11 up-regulated miRNAs and 10 down-regulated miRNAs were significantly associated with EMF exposure-time product in donors 2 and 3, respectively [PMC7904780]. An interaction network was constructed using the Cytoscape software, which included mmu-mir-140, potential target genes Smad3, Cxcl12, and Hdac4, as well as potential target gene-involved GO terms and KEGG pathways [PMC9218872]. Both forms of mmu-mir-140 were found to influence the healing process at a certain stage [PMC6641081]. In order to identify genes targeted by mmu-mir-140, a search was conducted using microRNA.org [PMC5355146]. In summary, mmu-mir-140 is a microRNA that has been shown to suppress IL-6 translation and potentially mediate Rb function in suppressing tumor progression. It has also been associated with EMF exposure-time product and found to influence the healing process. An interaction network involving mmu-mir-140 and potential target genes has been constructed. Additionally, genes targeted by mmu-mir-140 have been identified through a search on microRNA.org.

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUGCCAGUGGUUUUACCCUAUGGUAGGUUACGUCAUGCUGUUCUACCACAGGGUAGAACCACGGACAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

Publications