Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-150 URS000075E14D_7955

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

dre-mir-150: Dre-mir-150 is an miRNA that is encoded by the orthologous pre-miRNA dre-mir-150 and is involved in the regulation of various biological processes [PMC3005926]. In a study to validate the expression levels of circRNAs, miRNAs, and mRNAs after infection with E. tarda, dre-mir-150 was randomly selected and its expression level was measured using RT-qPCR [PMC7857051]. It was also predicted to have a relationship with dre-miR-203a-3p, novel_circ_0001819, novel_circ_0003210, and novel_circ_0003372 [PMC7857051]. Additionally, dre-mir-150 was found to be significantly up-regulated along with dre-miR-34b and dre-miR-15a*, which are known to target c-myb [PMC4785739]. Furthermore, dre-mir-150 was found to be enriched in gills and skin [PMC2684549]. However, the formation of a G4 structure in dre-mir-150 and its role in regulating pre-miR-150 processing have not been previously explored [PMC10002522]. Overall, these findings highlight the importance of dre-mir-150 in various biological processes and suggest its potential role in regulating gene expression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCCCAAUCCUUGUACCAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Ictalurus punctatus (channel catfish) ipu-miR-150
  2. Tor tambroides (Thai mahseer) miR-150
Publications