Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-133a precursor (hsa-mir-133a-2) URS000075E14C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR133A2: The MIR133A2 gene is one of the top two mutated miRNAs, with a copy number gain in approximately 7% of patients [PMC4967895]. MIR133A2 encodes miR-133a2, which is located on chromosome 20 [PMC3599331]. A variant in MIR133A2, specifically a 79T > C substitution, alters the processing of the miR-133a duplex and increases the relative abundance of miR-133a-5p [PMC3599331]. This variant is located adjacent to the Drosha cleavage site in the stem-loop structure of miR-133a-3p [PMC3599331]. The presence of this variant may modify gene expression profiles in the atrium [PMC3599331]. A haplotype including several variants in MIR133A2 was found in a cohort with atrial fibrillation (AF) probands and controls [PMC3599331]. Additionally, a missense variant in MIR133A2 alters miR-133a duplex processing and strand abundance, resulting in accumulation of miR-133a-5p [PMC3599331]. This variant was found in a patient with AF and other cardiovascular conditions [PMC3599331]. Variations in MIR133A2 have also been associated with stable warfarin dose and insulin resistance [PMC6635724] [PMC7913585]. The relationship between the 79T > C MIR133A2 variant and AF is still uncertain [PMC3599331] .

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGAGCCAAAUGCUUUGCUAGAGCUGGUAAAAUGGAACCAAAUCGACUGUCCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUGUGCAUUGAUGGCGCCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

Publications