Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 702 (LINC00702) URS000075E104_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00702: LINC00702 is a long non-coding RNA (lncRNA) that has been found to play a role in various cancers. Overexpression of LINC00702 has been shown to effectively inhibit tumor growth in non-small cell lung cancer (NSCLC) by inducing apoptosis both in vitro and in vivo [PMC6428098]. LINC00702 is one of the 15 prognostic lncRNAs related to exosomes, along with MEF2C-AS1, SOCS3-DT, LINC01711, MRPL20-DT, MAL2-AS1, USP30-AS1, WASHC5-AS1, TBL1XR1-AS1, LINC02463, LINC02037, ZBTB20-AS1, BTBD9-AS1, SLC24A3-AS1 and CACNA1C-IT3 [PMC9789946]. It has been found that miR-181b-5p is the downstream target of LINC00702 and SPP1 is the target gene of miR-181b-5p [PMC9204424]. In colorectal cancer (CRC), the expression of LINC00702 is decreased and its downregulation promotes cell proliferation, migration and invasion by enhancing the PI3K/AKT pathway through inhibition of PTEN expression [PMC8753275]. Other lncRNAs such as SNHG3 have also been found to play a role in CRC malignancy by regulating different molecular pathways [PMC8753275] [PMC9204424] [PMC9789946]. Overall, these findings highlight the importance of lncRNA LINC00702 in cancer progression and its potential as a therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACACAACUCCACAUGACUCAGAAGCCCUUCUUAAAAUAAGACCAGACCACAUUCAUGGAGGCUGAGUCACCUCUAACCUUCCAAACUUGUGUCUUACCAAGAAUGAAAGGCAACCUAUGUAAAAACUAUGGGCUUUCUAGUAUAAAUAAAAACUACUCAUCUCCAGAAAAUAAACAAUGACUGCUAAGAUGAUUGAAAAAAGAAAGGAGAAGAAAGUAGCUUGUAAAAGCGUGUGAAAUGCAUUCACGUUGGAAUCUCCUACAGGCACUUCAGAAGACGAAGUGCUCCUGAUGGCUGCUUUCAAUCACUGGAAGAACCAUGAAAGUGCGAGAGAUUCCUCCCGGUGAAUGAAGCCAGCUCACCACCGUCAAGGGCAAGGGAUCAGCGUGUGUUCACAUGGAGGCCUCUCACCGAGGGAACCCAAGGGGGACAGCACAGGAAUUGCAGAGCCAGCACCCAUGGAAUGGGCAGGGAUUUGGGUUUCAUCCAACCAGCCAGUUGAUCAAUAAUCACUGAAUGUCUGUCACCCAUUGCAUCCUCUCCUGAGUAGUGAGGCUAGGCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications