Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1476 (LINC01476) URS000075E0FB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01476: LINC01476 is a long non-coding RNA (lncRNA) that has been found to have lower expression in glioblastomas (GBMs) compared to normal brain tissue [PMC5140055]. In a study using tissue samples from patients at the University of Virginia, the altered expression of LINC01476 was validated [PMC5140055]. LINC01476 is involved in a structural variation (SV) that disrupts the genomic region spanning YPEL2 to LINC01476 [PMC7675008]. This SV also involves other genes, including GDPD1, MIR4729, SMG8, PRR11, and YPEL2 [PMC7675008]. The RP17 SVs share a common duplicated region and have breakpoints in LINC01476 intron 2 and YPEL2 intron 4 [PMC7675008]. The RP17 SVs lead to the disruption of the genomic region spanning YPEL2 to LINC01476 [PMC7675008]. Furthermore, methylation levels in specific sites of LINC01476 have been observed to decrease with increased severity score [PMC9235511]. The top 10 CpG sites mapped to various genes including LEP, CDHR4, MAD1L1, CLK3, ESD, HPCAL1, PTH and three long non-coding RNAs with unknown function in bone metabolism (LINC00301 and LINC01699) [PMC9235511]. In summary, LINC01476 is a lncRNA that has lower expression in GBMs compared to normal brain tissue. It is involved in a structural variation that disrupts the genomic region spanning YPEL2 to LINC01476. Methylation levels of specific sites within LINC01476 have been observed to decrease with increased severity score.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUUCCAAAGAUGGAUGCAAAUGCUGGGAAAGCAAGAGUUGAAUUGCUAGCCAUGAGGAAAACGUAAGCCUGAGCUGUUUGCUGGCCAUCUUUGCUUCCACAUGGGGAUGGCCUGCCUGGAAAUGAAGCCACACAGAGAAAACAGAAGAGCAGUGAAGAGAAGGGUAAAAGGAGAGAUCCCAUGACAUGAUUUGCACUCUUAGAUCCAGUUAUGCCUGAUGCAGGACCCACCCCUUGGACUUCCCAUUUCCAGGAGCUAAAACUAGACUGAGUUGAGUUUCUGUCACUGACAGUUGACAGAAAAUAUCAACAAUCCAGCCACAUGGAGCCUCAUGGCAGUACCACUAACCCUGGUCACCACAUGAAUACUGACCAGAGGCAUUUCACCUGAAUCAACUGUUUGUGUUCUUAACUCCAUCUCCUCAUCUGCUUCCUGGAAGACCCAACUGACAUAGAUGGUUACAAGAAAUGAUUUCCUCCUUAUAAAACUCUAGCUUCUUGUAUAGAAGAUACCUAAAAAGUGUUUGCUGAAUGAAGAAAUAAAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications