Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1825 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1825 precursor URS000075E057_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1825: MIR1825 is a microRNA that has been studied in the context of familial ALS and PMSII. In patients with familial ALS, MIR1825 was found to be downregulated, along with miR1234-3p, while other miRNAs showed regular expression [PMC9100918]. However, in a recent study on sporadic ALS patients, MIR1825 was the only miRNA found to be downregulated [PMC6416171]. The downregulation of MIR1825 in both familial and sporadic ALS suggests its potential involvement in the disease pathology. In PMSII, MIR1825, along with miR4291 and miR1245b-3p, may play a role in homeostasis and pathology [PMC8684662]. These three miRNAs were also found to potentially regulate immune-related gene expression [PMC8684662]. Additionally, MIR1825 has been identified as one of the differentially expressed miRNAs in pNETs compared to pancreatic ductal adenocarcinoma [PMC9554633]. The identification of MIR1825 as a differentially expressed microRNA suggests its potential as a biomarker or therapeutic target for these diseases. Further mechanistic studies are needed to fully understand the roles of MIR1825 and other identified miRNAs in disease progression and their potential implications for diagnosis and treatment.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAGACUGGGGUGCUGGGCUCCCCUAGACUAGGACUCCAGUGCCCUCCUCUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications