v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1348 (LINC01348) URS000075E04B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01348: LINC01348 is a long non-coding RNA (lncRNA) that has been implicated in various biological processes and diseases. It has been identified as one of the six lncRNAs obtained through stepwise multiple regression analysis [PMC8195339]. LINC01348 has been found to interact with splicing factor SF3B3, promoting the skipping of exon 14 of EZH2 pre-mRNA [PMC9023592]. Additionally, it has been shown that BDE-47, a flame retardant, induces the expression of LINC01348 in hepatocellular carcinoma (HCC) [PMC9697228]. LINC01348 is also identified as one of the main hubs in a network analysis involving induced differentially expressed lncRNAs (DELs) and differentially expressed proteins (DEPs) [PMC9697228]. Furthermore, it is found that LINC01348 is induced by BDE-47 and -209 congeners, as well as by BDE-99 and -209 congeners [PMC9697228]. In a study comparing different subject categories, LINC01348 was found to be shared among all three subject categories: NwCRC patients, Ob patients, and ObCRC patients [PMC7351520]. References: - [PMC9684446] - [PMC8195339] - [PMC9023592] - [PMC9697228] - [PMC7351520]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGCCACAUUUGCUGCCUUUCUGGGAGAGUUAGAAGCAAGCCACGUGGGUGACUUCUUUUCAAAGUUCUCUGCCUCAGAGGAGGAAGCCCCAUGGGUGGAGGCCAGGCCCGAGGCCAUCCUGCUCUGGGCCAGAGCGUGCCUGUGUCUGAUGAGCGAGGACAUGCCUCGUCUGGCUGAGCCUUCCAUUUCACACCGGCAGCUCGAACCCCCCAUCACGGCUUCCUUUUGGGCUCCCCUCCUCAGGGGACCGAGCUUGAAAUGUGCUUGCCCUUCAUCCCUAAGGCCUGCGUCCCUUCCUCAGAGAGGACUAAGCCCCUCUCCCAGUCUUGAUGUUCUCCGAGGCCCUUCUUAUUCACAGAACCUAUCUGGCUUAUUUAUUCGCUUGCUUGCUUCUGAUGUCUUCUCUUACUGAAAGGAAUCGAAGGGCCAAGGAAUGUGUUUUUCGUUGAUGUCAACUUGCUGCAAAGGACCACACCUGCUUCUCGACCCAGGAACGUGGGAAAGGGAAAGGCUUGGCUUGUUUUGGUGGAGAUGGAGAUGCUGGUAACAGUGGAGGAAUGCCCUCCUUCUGAUUCACAGUGGGGAGGUGCUCUGGGCCCCUGCCACUGCCCGAGGACUUCAGCUUUUGGUUGUCCUGCUGAGAGGAUGCGGCAUUUGAGCAGUAGCUUCUGGAGCCCAGAGUGAAGCCCCACCCAGGCACCCUGACAGGACCACAGGAAUGCUCCUGGCACAGCAAGCAGGACUCUUGAGAAGCUCAGCCUCCACGCUCCUUGUAGAUGUUCAGUUCAAACUCCACAGUUUGUGUGACUCACUGAAGGGCUUGGUUUGGCUCUCGCUGACGAGUCUGUCAUCGGUGCCAGACAACCGGGUUUCACCGUGUUAGCCAGGCUGGCCUCAAACUCCUGACCUCAAGUGAUCCACCCGCAUCGACCUCACAAAGUGCUUGGAUUACAGGUGUGAGCUACUGUGCCAGGCCAGAAAAAAUAAAAUAAAAUAAAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications