Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-506 precursor URS000075DF7E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR506: MIR506 is a microRNA that is upregulated in the intrahepatic bile duct of patients with primary biliary cholangitis (PBC) and regulates the secretion of biliary epithelial cells (BECs) by targeting AE2 [PMC8147992]. However, a specific interaction between endogenously expressed miR124 and MIR506 does not account for the decrease in expression level in astrocytic cells [PMC5476465]. In pancreatic ductal adenocarcinoma (PDAC), the replacement of MIR506 induces autophagy [PMC9312874]. Overexpression of MIR506 leads to an increase in BCL2 gene expression [PMC7477680]. Low expression levels of MIR506 may contribute to higher levels of CDK6 and CTNNB1 mRNAs in adrenocortical carcinomas (ACCs) [PMC5764399]. MIR506 is part of a group of noncoding RNAs, including miR-34, miR-155, and miR-21, that regulate the reactive oxygen species-cancer axis in various malignancies, including lung cancer [PMC9442502]. In T-cell acute lymphoblastic leukemia (TALL), transfection with MIR506 leads to an increase in its own expression [PMC7477680]. In wheat, 58 miRNAs have been discovered, including MIR506, which targets AB182944 encoding a knox1b homeobox protein [PMC5360763]. Finally, PCR analysis using specific primers reveals binding sites for SOX9 and TEAD1 on the promoters of SOX9 and MIR506 genes respectively [PMC6756096].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCACCACCAUCAGCCAUACUAUGUGUAGUGCCUUAUUCAGGAAGGUGUUACUUAAUAGAUUAAUAUUUGUAAGGCACCCUUCUGAGUAGAGUAAUGUGCAACAUGGACAACAUUUGUGGUGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications