Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1281 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1281 precursor URS000075DF7B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-1281: Hsa-mir-1281 has been identified as a potential biomarker for predicting the radiosensitivity of nasopharyngeal carcinoma (NPC) [PMC7083955]. Through the use of three databases (miRDB, miRTarBase, and TargetScan), 97 candidate mRNAs targeted by hsa-mir-1281 have been identified [PMC8667166]. In colorectal cancer (CRC), the expression levels of hsa-mir-1281, along with other miRNAs, have been preliminarily detected [PMC8941573]. Hsa-mir-1281 has also been found to be a p53-responsive microRNA that targets USP39 to inhibit the survival of human osteosarcoma cells under ER stress [PMC8667166]. The diagnostic potential of hsa-mir-1281 has been demonstrated with an AUC value of 0.750 for predicting radiosensitivity in NPC [PMC7083955]. Furthermore, hsa-mir-1281 has been selected, along with three other miRNAs, to confirm microarray analysis results in NPC through qPCR [PMC7083955]. In network analysis studies, hsa-mir-1281 has been identified as one of ten hub miRNAs in the green module [PMC7402807].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGGGGCACCGGGAGGAGGUGAGUGUCUCUUGUCGCCUCCUCCUCUCCCCCCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications