Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1127 (LINC01127) URS000075DF7A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01127: LINC01127 is a long intergenic non-protein coding RNA (lncRNA) that has been associated with various diseases, including cancer and COVID-19. Studies have shown that LINC01127 is upregulated in tumor tissues compared to normal tissues, and its increased expression has been observed in ovarian tumors and clear cell renal cell carcinoma [PMC9898620] [PMC8322527]. In addition to cancer, LINC01127 has also been implicated in other diseases such as Type 2 diabetes [PMC8764313]. In COVID-19 patients, upregulation of LINC01127 has been observed in the severe group compared to the mild group [PMC8708613]. Furthermore, LINC01127 is among the lncRNAs that have shown potential diagnostic value for acute myocardial infarction (AMI) [PMC8322527]. It has also been reported that LINC01127 can regulate cell proliferation, migration, epithelial mesenchymal transition (EMT), and invasion of human ovarian cancer cells [PMC8805187]. Overall, these findings highlight the importance of LINC01127 as a potential biomarker and therapeutic target for various diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCUUUUCAUCCAGUGAGGACACAGGGAGAAGAUGGUCAUUAGCGACCAGGAAGAGGGUCCCCCCACCAGAACCCCAUGCUGGCACCUGAUCUCGACUUCCGGCCUCCAGAAAUCUUUGAGAAGCAGAUAGGCUUGAAUGAGCAUGGAAUGUAUCUAUUUAAAAAGCAGCUGGAAGUCUGUCAAGUGCAUUCUGGAAAUGGAUUCAGGCUAACAGAGUGUUCUGAAUAGAGACGCCUAAAACAAGAGCCAAAGACAUAGCAAUGGAGAACGUGGGUGGUACAGCCCUCCACCCUGGCGAGCAGCACAUUAGAAUCACGUAGGAGCUUAAAAAGUACUGACUGGCCUGGUCUUUUUCGGUGUGAAGGUGGGAUGCAGGCUUCCUGGGGUUAUCCUCUCGUACAGCCAGAGUUGAGAACCAUCUGAGUAGCGCUUGUCACACUUCUGGCCACAUCAGAAUCGUCUGAGGGACUUGUUCACUGCAGGUUGCUGGGUCCCAUCUCUAGCCUCUGAUCCAGUAGCCUGGGGUGGGGCACAGGAUGUCCUGCUGCUGGGGUCUGGGCAGCGCUAUGAGAACUGCUGACGUUGGAGCUCGAUCAGGCAAUUGGACCACCCAAAUGGCAAACUAAAAGCAUAGAAGCGGACACCAGAGGCUCCUGGACCUGAGAUGUGGCCCUGGAAGUGACCAGAUGUGGUCUCAAGAGAUGGGGGCCCAGGGCUAGGAAUGCCGCCAUCCGGGGAGGCCCUAGAGCAGAGCAGAGCAGCUGUGGGCUGGUGCCAAGCUCACUCCUGCUUCUCUCUGCACGUCUCCCUCAUUCUUUUCUCUCUGAACUGUGACCCUUUUGGCCCCUCUGAGUACCAGGUGGGACAAGGUGACCCCUCAGCACUUGAGUUUACACCUUAGAUGUGUAGGUCCUCACAGAGGCCAACUUAUCUCCUUCUGGGACCAAAUUCCAAAUUCCUAAAGAAAAAACAAACCAAAAACGGAUAUGAUAAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications