Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) NFIA antisense RNA 1 (NFIA-AS1) URS000075DF37_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

NFIA-AS1: NFIA-AS1 is a long non-coding RNA (lncRNA) located on chromosome 1p31.3 [PMC10089782]. It has been shown to be involved in the regulation of atherosclerosis (AS) through the miR-125a-3p/AKT1 axis [PMC10089782]. Knockdown (KD) of NFIA-AS1 in oxidized low-density lipoprotein (Ox-LDL)-induced vascular smooth muscle cells (VSMCs) reduced the expression of inflammatory and adhesion factors, suggesting its role in regulating inflammation in AS [PMC10089782]. NFIA-AS1 was found to be highly expressed in Ox-LDL-induced VSMCs and AS tissues, and its overexpression promoted AKT1 expression by sponging miR-125a-3p, thereby promoting VSMC growth and inflammation [PMC10089782]. NFIA-AS1 KD improved AS symptoms in mice, as evidenced by reduced levels of inflammatory cytokines [PMC10089782]. The targeting relationship between NFIA-AS1 and miR-125a-3p was confirmed through luciferase reporter assays [PMC10089782]. Furthermore, NFIA-AS1 KD inhibited VSMC growth, migration, invasion, and promoted apoptosis induced by Ox-LDL [PMC10089782]. The correlation between NFIA-AS1 and AS was analyzed using the LncBook database [PMC10089782]. This study is the first to elucidate the involvement of NFIA-AS1 in regulating AS through the miR125a3p/AKT axis [PMC10089782]. References: [PMC10089782] Liang Y et al. LncRNA-NFIA antisense RNA 1 negatively regulates ox-LDL-induced inflammation via targeting miR125a3p/AKT axis. J Cell Mol Med. 2020;24(24):14461-14473. doi:10.1111/jcmm.15661

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCCAUGAGAAGCUCAAGUUCACCAUGAGCCACAGCAGUAAGCCAUGCUUUAGCCUCUGACCUGUGCUCCAAUUUUGGUACAAUGAUUUCUGCCAUGUUCUCCAACAGGGUGAGGAAACAGACAGCACUAAGAGAAAAAGCUGGAACUCAAAACCAAAUUAACUCCAAACUUAAGUUUUCCCACUUCGACAAGAAAAGGAACUGCAUGUGUUUUUCUGCCUCUUGCAGAUGUAUGUCAUAAAAGUUGGAUGCCUUCCUUUCAAGACAUUUGAAUGGAUCACCAAAUAAUUACCUACUUUUCUCUCACAACUCAGAUAAAUAAUUAAAAGGAGAUAUACACAGAUUGGUUGCAUACUUAAGAGUGAGAAUCAAUUAAAACAAAAUUGUAUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications