Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-1293 precursor URS000075DE57_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1293: MIR1293 is a microRNA that has been studied in the context of lung adenocarcinoma (LUAD). Univariate Cox regression analysis has shown that high expression of MIR1293 is associated with poor survival outcomes in LUAD [PMC7212445]. In contrast, high expression of LINC01740, another gene in the ceRNA network, is associated with good survival outcomes [PMC7212445]. In a combined step regression and Cox regression analysis, MIR1293 was identified as one of four genes that serve as prognostic biomarkers in LUAD [PMC7212445]. Furthermore, MIR1293 was found to be a novel important prognostic factor involved in LUAD pathogenesis [PMC7212445]. In a study comparing expression levels between high-risk and low-risk groups, it was observed that the expression level of MIR1293 was higher in the high-risk group [PMC7212445]. Additionally, MIR1293 has been shown to be involved in the regulation of vIL-6 and hIL-6 through binding sites in their open reading frames (ORF) [PMC9495386]. Expression deregulation patterns of several miRNAs, including MIR1293, have been observed in leukoplakia and leukoplakia-transformed cancer tissues [PMC5011738]. References: - [PMC7212445]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7212445/ - [PMC9495386]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9495386/ - [PMC5011738]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5011738/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGUUGUUCUGGGUGGUCUGGAGAUUUGUGCAGCUUGUACCUGCACAAAUCUCCGGACCACUUAGUCUUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes miRNA
Publications