Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) microRNA gga-mir-499 precursor URS000075DE49_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-499: Gga-mir-499 is a differentially expressed miRNA related to muscle function [PMC7326969]. It is one of the targets used to construct miRNA-lncRNA and miRNA-circRNA interaction network diagrams [PMC8531282]. The role of gga-mir-499, along with other miRNAs such as gga-miR-1, gga-miR-196-5p, gga-miR-193a-3p, gga-miR-34a-5p, gga-miR-221-5p, and gga-miR-126-3p, has been extensively studied in myofiber type [PMC8531282]. The correlation coefficients of these miRNAs with other factors ranged from 0.63 to 0.99 [PMC7038564]. Gga-mir-499 has been predicted to target ACVR2B in a network analysis [PMC9364561]. In the ovary, gga-mir-499 is associated with multiple pathways including reproductive processes, cell cycle, p53 pathway, and apoptosis [PMC5940789]. Gga-mir 499 is one of the muscle-related miRNAs differentially expressed between broilers and layers [PMC3107184]. It has been predicted to target ACVR2B along with two other miRNAs: gga-miR101 and gaa-miR1a [PMC3107184]. References: [PMC7326969] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7326969/ [PMC8531282] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8531282/ [PMC7038564] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7038564/ [PM9364561] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9364561/ [PMC5940789] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5940789/ [PMC3107184] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3107184/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGAGGGAGCGGCAGUUAAGACUUGUAGUGAUGUUUAGAUAAUGUAUUACAUGAACAUCACUUUAAGUCUGUGCUACUUCUCUCCUCAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

Publications