v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1341 (LINC01341) URS000075DDBF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01341: LINC01341 is a long non-coding RNA (lncRNA) that has been implicated in thyroid cancer. Copy number variation (CNV) analyses have shown that LINC01341 is accompanied by copy number gain in thyroid cancer [PMC6089163]. Additionally, genomic alterations, including copy number amplification or deletion, have been observed in LINC01341, suggesting its involvement in the dysregulation of lncRNAs in thyroid cancer [PMC6089163]. LINC01341 has also been identified as one of the lncRNAs used to construct a prognosis model for predicting patient prognosis and immunotherapy sensitivity in lung squamous cell carcinoma (LUSC) [PMC9355133]. Clinical correlation analysis has shown that the expression of LINC01341 is associated with worse clinical features such as age and clinical-stage progression [PMC9355133]. Furthermore, LINC01341 has been identified as one of the lncRNAs significantly associated with patient prognosis [PMC9355133]. In a study investigating ER-lncRNAs and their correlation with immune genes, LINC01341 was found to be significantly associated with immune genes [PMC9843421]. Overall, these findings highlight the potential role of LINC01341 as a biomarker for cancer prognosis and its involvement in immune-related processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCGCCCUCUCCAGCUGGAAGAAGUCGUAAUCGAACCUGCUCAGGUCCUCACUGCCCCACUCCGAAGGAAACCCCACGUACAGGUGAGGUCAGAGGAGUGAAGUGACUUGCCCAAGACCACACAGUGAGUCAGGAGCAGGCCUGUCCCUCCAGCAGUGGUGCCAUGUUGUCCCCAAGCCAUGGUGGCAGAGGAGCUGGUGUGAACGCCCCAUCCUGCCACGUCUGUGAUGUGGGCACCUCACAUGACUGUCCCCUCCCAGCUCUUGGGGGGGACCUAGGACAUUCUGUGAGCCUGCAGGAAAGUUUACCAAAUGCUGCAGCUUUGUCCUGGUGGUGAUGGGCACCCCGUUAACGGCAACCUUGCAUUUGCUAUGUGGAGUGACCGUCACUUUACCGUCGGCAUUUGUGAAGGAAGCGUGUUUAUCUGAAAUUCUAAGAAGAUGAGAGUCAAAGACACCCAGCAAACGGCGGUUUCCGUGAGCAGGUAGGCUGACCUUUCUCAUGUGCACAGGAGGGAAGGUCUACAGCUGCGGAGGAUGGCAGGUGGCAUCUCGGGGCCUCCUGUGUGCUGUGGCCCAUGAUGCAUGGGGACAGCAGCGGGCGCAGAAGGACCCUGCCCUUGGGGAGCACGGGGAGCUGGGAGACAGCAGGCAAGGGCUUCAUUAACAGAACGAACACCAGCUGAGGGCCUAGCACUGCGGGGAGCCGGCCAAGGCCACACUGGAGUCCUCCCGCUCCCAGGCCAGCGGGAUGGGGUGGUGGGAAGAUGGCAGCAAGCAAGCUUCAGAAGAGACGCUCAGGAGGCGACUCUUAACGAGCCUCACCUACUCCGGGUACGUUUUGAUCUGUUUCUGCGCCCUCGCCGUAUAAAUUCAGACCUUAUAGGAUUUGGGGCUGGACGUCGGGGUGUCAGGUUGGCAUCCCCUCUCCCCGCCCUGCUCCCCUGCACCGAUGUCAUCUGUGUGUCCUGAAUGACUGGCUCCCUGCCUUAGCAUGUUCCAUGUUCCUGCACUCCUUGGCCAUCAUGGAAUGUUCUGGAUGUGGAGACCCGUGUGCAUCCAAACCCUUUUUUGCAUGGGGCCCAGGGAUCCUGUGGGAAAGGUUGCGGCCUCAUCACUGGAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications