Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) RNA, U5E small nuclear 1 (RNU5E-1) secondary structure diagram

Homo sapiens (human) RNA, U5E small nuclear 1 (RNU5E-1) URS000075DD00_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

RNU5E-1: RNU5E-1 is a small nuclear RNA (snRNA) that has been studied in relation to hepatocellular carcinoma (HCC). Research has shown that the expression of snRNA RNU5E-1 is lower in HCC tissues compared to adjacent tissues [PMC9667552]. This finding suggests that RNU5E-1 may serve as a useful biomarker for predicting the diagnosis and prognosis of HCC patients [PMC9667552]. Furthermore, RNU5E-1 has been associated with various clinical characteristics of HCC, including tumor size, vascular tumor thrombus, differentiation degree, TNM staging, tumor recurrence, and long-term survival [PMC9667552]. In a recent study by Ding et al., it was suggested that RNU5E-1, along with SNORD31 and SNORA71A, could be used as prognostic genes for HCC [PMC9524901]. Additionally, RNU5E-1 is one of the highly represented transcripts in non-coding nucleolar and nuclear RNAs found in HCC cell lines [PMC5669939]. This indicates its potential importance in the molecular landscape of HCC. Overall, these findings highlight the significance of RNU5E-1 as a potential biomarker and prognostic gene for HCC.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUCUGGUUUCUCUUCAAAUCGUAUAAAUCUUUCGCCUUUUACUAAAGAUUUCCGUGGAGAGAAACGAGUGUGAGUCUGAAACCAAUUUUUUGAGGCCUUGCGUUUUUUAGCAGGGCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications