Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-671 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-671 precursor URS000075DC96_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR671: MIR671 is a microRNA that has been identified in various studies and has been found to play a role in different biological processes. In one study, six miRNAs, including MIR671, were identified, but only miR1226 showed statistically significant differences [PMC6764711]. Another study found that MIR671 is present in EpCAM-Exos and is one of eight novel miRNAs identified [PMC5137021]. Multiple studies have shown that MIR671, along with other genes such as Lcn2, Cd74, and Cebpd, play a role in the immune response of macrophages and/or microglia as retinal degeneration increases [PMC8362665] [PMC4872275]. Additionally, MIR671 has been found to be involved in regulating extracellular matrix production and acts as a sponge for its target transcript [PMC4872275] [PMC9918958]. In the context of preeclampsia, MIR671 was found to be increased along with other miRNAs associated with various processes such as injury, oxidative stress, inflammation, and hypertension [PMC5933288]. Furthermore, MIR671 was identified as one of the upregulated intragenic miRNAs residing within upregulated genes in non-protein coding regions [PMC5823624]. These findings highlight the diverse roles of MIR671 in different biological contexts.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAGGUGAACUGGCAGGCCAGGAAGAGGAGGAAGCCCUGGAGGGGCUGGAGGUGAUGGAUGUUUUCCUCCGGUUCUCAGGGCUCCACCUCUUUCGGGCCGUAGAGCCAGGGCUGGUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

2D structure Publications