Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1798 (LINC01798) URS000075DC4A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01798: LINC01798 is a long non-coding RNA (lncRNA) that has been found to play a role in various biological processes. In a study, the knockdown of LINC01798 resulted in the downregulation of ITGA8 expression at both the mRNA and protein levels, while the expression of miR-17-5p was slightly upregulated [PMC9995370]. Conversely, when LINC01798 was overexpressed, ITGA8 expression was upregulated and miR-17-5p mimic could reverse this effect [PMC9995370]. Additionally, LINC01798 knockdown led to downregulation of immune checkpoint genes that were positively correlated with ITGA8 expression, while overexpression of LINC01798 elevated their expression [PMC9995370]. The expression levels of LINC01798 and ITGA8 were significantly lower in lung adenocarcinoma (LUAD) cell lines compared to normal lung tissue cell lines [PMC9995370]. The binding between LINC01798 and miR-17-5p was found to be important for their regulatory interaction [PMC9995370]. Furthermore, LINC01798 has been identified as one of the lncRNA biomarkers associated with chronic rhinosinusitis with nasal polyps (CRSwNP) [PMC9106458]. In another study, elevated expression levels of LINC01798 were observed in malignant pleural effusion compared to benign pleural effusion samples [PMC9756994]. Overall, these findings suggest that LINC01798 plays a role in regulating gene expression and may have implications in various diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGCUAGGGGAGGGAGGUUUACAAGUGAAGAGUAGUUAGGGAAUAUGGUGACUCUGAAGAAUCGAGAUCAGCAGUGUCCAGGAAUUAGAAAAAAUAAACUGCUAUUUCCGUGAGUUCCCCCUCUGUGAGCCAUUUAGGUAGUGCUGUCCUCAGUCUCUUGGGGCAUACUUCUUUCCCGAUCUGGCACAAAUGACCCCUCAGGGCUUAAAGACUUGAGAAUGACAGAUGAUCAAGCUCUGGACCCAUGUUGAAAGCAGACUUCUGUGAGGAGAAAGAACAGCUGUUUACCAUCUUCCCAGAGUCAAAUUGAACACACUGGAACAGAGAGAUUGCAUUCUUACCCAAAUACUCUUCGUGAUUGCCUGCUUUGCGGCUUUGGGCCGAUGCAAGCUGCAAAAUGGCGAGUCUUCUAAGGUGCCUUUCCUUCCCUGGGAUCCUCAUCUUAGAAUGAGCAGAGGCACAUCGAUAAGAACUGGACCUUGAUUUCACAACCUCAUACAAAGCCAGGCAAUUCUUGAGCCAAACAAAGGGGGUGUAAGCUAUUUCAUUUAUUUUGAUAAUCCUCCUCUUGCACGGGAGCAUUUUGCUGUCUUUGUCAAAGUGAAUGACAACAAUUUGGCCAACUCUCUCUGAGCUGCACUCAACAGUGACAGGCAAAUUAUCAGAGGCCCUGCACUUCUUAUUAUCAGAGGAGAAGCCAUCAGGGGGACGCAUGGAGGAUACCUCUCCCUUGUCACUAUUUGUCAGUGGGACAAGGGCCACUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications