v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) GAS5 antisense RNA 1 (GAS5-AS1) URS000075DC2A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

GAS5-AS1: GAS5-AS1 is a long non-coding RNA (lncRNA) that plays a role in cervical cancer (CC) by interacting with RNA demethylase ALKBH5 to decrease m6A modification of GAS5 and increase its stability through the YTHDF2-dependent degradation pathway [PMC7408378]. This interaction leads to an increase in the expression of the tumor suppressor growth arrest specific 5 (GAS5) [PMC7408378]. GAS5-AS1 acts through the ALKBH5-m6A-YTHDF2 axis to regulate cancer growth and metastasis [PMC7408378].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAAAAAAAGGAAAAUUCAGAGAGUAACUGAAGUUUUAUCAUUAAUGGGACUAAAGUGCUUUAGCCCAGAAACAGAUUUGUAAAACCAUUACUGCUAACAAAGACAUCAUUAUAAGCACAGCUGUACUGACACUGAAAUUAAAAUUUGACCCAUCUUGGAAUUUUGGCCCCUUGGUCCUGUUUCCCUGGGACAGAUUGCCUUAAACCAGUUGUGCCCUUUAUACCCACUUUUGGCAUCCCUAAACACUUAGUGCUUGCCAAAAACCUAUCACCAUGGCUAUGGAUUGUAGAUUUUCCCAAUUCCAUUAAUGCCUAUCACUAGUUGGGCAUUUCUAUAGUAUUUUCUAUAACUUAUUUUCCCAGCCUCAGACUCAACAUGACUUUCUCCAAGUAGCUCCAUCAAUACUUUAAGCUCAAAACCAAUUAGCACAGGGGCCUAUGAAACCUGACAAUUUGCUCAUAUGGAGAAUUAGGAAAUAUUGCACUUUAAUGCAUAAGACACCUUGUAAAAUACCCAUAAAAUUUUAACUGGCUGCAGUGUUAAUGAAGCAAAUACCAUGGAGUUAUAAUAGCUUUUGAAUGUGAUUUAUGCUUACAGCUAAUGAACAGAUGAAAAGCACUGUCCUUUUUUAAGUAAACACUACACACUCCAGAUGGAUUGCAAAAAUUUAUUAAAAUUGGAGACACUGUUUUAAAAAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications