Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 709 (LINC00709) URS000075DB9C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00709: LINC00709 is a long noncoding RNA (lncRNA) gene that belongs to the category of lncRNAs with important regulatory functions in the expression of multiple genes [PMC6587859]. In a study of patients with no family history of colorectal cancer (CRC), the LINC00709 rs10795668 and rs11255841 variants were associated with a lower risk of colorectal adenomas [PMC6587859]. These variants maintained statistically significant associations even after Bonferroni correction [PMC6587859]. Additionally, the LINC00709 rs10795668 and rs11255841 variants were associated with a reduced risk of adenomas in patients with no family history of CRC [PMC6587859]. Other single nucleotide polymorphisms (SNPs) in LINC00709, as well as in CDH1, were also associated with a reduced risk of developing colorectal adenomas in patients without a family history of CRC [PMC6587859]. In contrast, an intergenic variant (rs4779584) was significantly associated with an increased risk of high-risk adenomas [PMC6587859]. Furthermore, the LINC00709 rs11255841 variant was significantly more frequent in first-degree relatives (FDRs) of patients with CRC who had low-risk adenomas [PMC7861964]. This variant is located in the LINC00709 gene at the 10p14 chromosomal region [PMC7861964]. In summary, specific variants in LINC00709, such as rs10795668 and rs11255841, are associated with a lower risk of colorectal adenomas and may play a role in early stages of CRC development regardless of family history [PMC6587859][PMC7861964]. These findings highlight the importance and potential regulatory functions of lncRNAs like LINC00709 in colorectal cancer development.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACAGUUCACCUGCCUGGCUUCUGUAGCCAUGGAUACUCUCUCAGUUUUUAUCCUGUGCUCUUUUAGGGGCAAAACCCUGCCUUCUCACCAGUCUCUACCAGAAGUUAUUCAAAUUAAACGUCUUAUUGUUUUCAUACUUUAAUUGAAGAUAUGGACAGUCACAAAAUGGGUUUCUUUGCACACCCACCAUAGCCACUUGUAACUACAAAGAUGUUCUUCUCUUCGUUCUUUUUCCUACUCCGGAUCAAGAGCCUGGAUUUCCGGCUGAAAUACAACACCGUGCAUUCUCCAAUGUAUAGCCUAGCUUUGGGUCAAAAAUCUAGGACCUGCUGCAAGAAUUACUACGCACUCAAGUUCUCUGCACACUGAGCACGAAGGUUCAUUGGAAAGGAGACUCUUGUGAGGCCUUGAAGCACAUCCAUUCACACCUAAUAAUUGUACAGAUAUGAAAAGUAACAUCAGAGAAGUAAAGAUUUUUCUAGGAGGCCAUUUAGGUUUUGCUCUGUGCUUUAUUCUAUCACAUUAGGCUGCCUUAUUCUCUGUUACCUGCAUAUCUAUGGUAGUAUUAAAAGUAAGCCAUUUUCAGUUUGCGUUAACAAGAUGGAUGUCUGAAAACCAAAUACAACUGGAAAAUUCAAUCCAAGUUACUGAGGUUUGACUGAGAUAUAUUGAUUCUUAAAAAACAAGAUAAUAAACUCUAAAUAUCCAUUGAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications