Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens small nucleolar RNA, C/D box 14E (SNORD14E) URS000075DB88_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD14E: SNORD14E is a small nucleolar RNA (snoRNA) involved in RNA processing and is associated with neurodegenerative disorders such as Alzheimer's disease, Parkinson's disease, and Huntington's disease [PMC4822961]. It has been identified as a TSS-Seq peak in mouse samples, indicating its exact 5'-end [PMC6020437]. While some researchers interpreted this peak as evidence of a novel long non-coding RNA (lncRNA), others recognized it as SNORD14E [PMC6020437]. SNORD14E has been found to be under-expressed in various brain regions [PMC4822961]. It is one of the non-coding RNAs that show upregulation following memory acquisition and retrieval [PMC4460846]. Additionally, SNORD14E has been identified as one of the top upregulated genes in certain contexts, such as primary AML1-ETO+ samples with high leukemia stem cell (LSC) content [PMC8629011]. In some studies, SNORD14E was found to be differentially expressed and overexpressed in specific cell populations [PMC3962421] and brain regions such as BA9 [PMC8280514]. Overall, these findings highlight the potential role of SNORD14E in various biological processes and its association with neurodegenerative disorders.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGAUGAAUGGUCCAAAACAUUCGCGGUUUCCACCAGAAUUCAAGGUGUUGGCAACUACCUUCCUUGGAUGUCUGAGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications