Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-133b precursor URS000075DAC1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR133B: MIR133B is a microRNA that has been studied in various contexts. In one study, it was found that the long non-coding RNA (lncRNA) LOC400043 interacts with MIR133B, leading to the downregulation of its expression [PMC7068214]. Another study demonstrated that the insertion of miRNA target sites for MIR133B and miR206 into the NP genome segment of influenza A virus effectively attenuated infection in murine myocyte-like cells and in the heart [PMC9094651]. In addition to these findings, other researchers have also investigated miRNAs in Parkinson's disease (PD) tissues, including MIR133B [PMC3540391]. Furthermore, the effect of intranasal delivery of MIR133B on functional recovery was assessed using two behavior tasks: GSM for forelimb grip strength evaluation and hanging task for forelimb grasp assessment post-spinal cord injury (SCI) [PMC10047048]. These studies highlight the importance of MIR133B in various biological processes and its potential therapeutic applications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUCAGAAGAAAGAUGCCCCCUGCUCUGGCUGGUCAAACGGAACCAAGUCCGUCUUCCUGAGAGGUUUGGUCCCCUUCAACCAGCUACAGCAGGGCUGGCAAUGCCCAGUCCUUGGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

Publications