v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) LRRC2 antisense RNA 1 (LRRC2-AS1) URS000075DA5B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LRRC2-AS1: LRRC2-AS1 is an antisense gene that overlaps with the LRRC2 gene and is preferentially expressed in embryonic stem cells (ESC) [PMC8594701]. LRRC2-AS1 has very low RNA levels in many tissues, with the highest expression in the testis and extremely low expression in skeletal muscle (SkM) [PMC8594701]. The LRRC2-AS1 transcript is predicted to encode a protein with 171 amino acids, but its functional assessment is limited due to the absence of conserved domains [PMC8594701]. The risk score model for relapse prediction includes the expression levels of nine relapse-related long non-coding RNAs (lncRNAs), including LRRC2-AS1, which has a positive weight of 0.091 [PMC5045428]. LRRC2, which overlaps with LRRC2-AS1, is preferentially expressed in ESC as well as in muscle and heart tissues [PMC8594701]. The upregulated expression of both LRRC2 and its intron-1 non-coding RNA gene, LRRC2-AS1, suggests a previously unreported role for LRRC2 in ESC [PMC8594701]. These findings highlight the potential involvement of LRRC2 and its antisense gene, LRRC2-AS1, in ESC function and provide insights into their potential roles in relapse prediction.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGACUGUUUUCGGACUCAGCCUGCCUACACCCAGGGCUGAGGGAGCACAUCCAAGGAAGGGCCAACUUGGAAGGGGUUCAGCCCAUCAGAUAGCAGCUCAGGAGUAUCUAACCUGCAAAGAUCUUAAUUAAGGCUUUGGCUUUCGACUUAAAAGUCUCCAUAAAGGAACGCUACGCAUCAUCCUGAAAAUAAAGAUCAAAGUCCACAGCCAGUGGUGAAGAAACAUUAAUAAGAGAAUCAGUCAGCCUAGUUUUUUUGAGGAAAUCUGUGCACAGAUCCCAAGUCUACACAUAAACCAAAAAGCCAAAGUAAAGUUAACUGUAUUUGAGCAGUGUGGGCAGCCCAGCCAGCCACAGUAACUGAAGCUGGAAGAAUUACUCCCUACACACAGGGCUCGUGUUCUCUAGAUCAACCAGACACAUCACAGACUCUGUUGUUGAGGUUCUUUCAUUUCCUCAGGCCAGUUAGCCCUUGGCUAGUAGCCAGAGCUGUACAUUAACUGCCCCUACAUUUUUAAAAUCAUUGCUUAUGAAUUUCUAUGUAUUAACUUAGAGAAAUGUAAUUCUAGUUCCCAUCUUAGAGGAAUGGUCUCUUCUUAAUGUCUUUGUGUUCUAAAUAUUUGAUCAUGUCAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications