Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) miR-17-92a-1 cluster host gene (MIR17HG) URS000075DA42_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR17HG: MIR17HG, a long non-coding RNA, has been extensively studied in various cancers, including colon cancer [PMC9247659]. It has been found to be closely associated with tumor immunity [PMC9247659]. In primary human CD34+ progenitor cells, the binding of TAL1 and E47 to MIR17HG was examined [PMC7722897]. MIR17HG was found to be expressed in both endothelial cells (ECs) and glioma-conditioned ECs (GECs) [PMC6180493]. The promoter activity of MIR17HG was increased by β-catenin and Δ45-β-catenin, but not by the LEF1 binding site-mutated reporter [PMC6549003]. In glioma tissues and cells, the expression of FXR1 and MIR17HG was elevated [PMC6348679]. Several single nucleotide polymorphisms (SNPs) in MIR17HG were genotyped to determine their effect on glioma risk or prognosis [PMC7547478]. The association of the MIR17HG rs17735387 polymorphism with stage III/IV HNSCC risk remained noteworthy [PMC7707933]. In the Chinese Han population, certain SNPs in MIR17HG were associated with increased or decreased colorectal cancer risk [PMC7457078]. MYC appears to regulate the expression of MIR17HG along with mir-17 and mir-20a [PMC9780260]. It has been observed that MIR17HG performs oncogenic functions in both NK-cells and T-cells [PMC5620138], while its expression is dysregulated in T-cell lymphoma and early T-cell progenitor ALL [PMC5944955]. Humans with heterozygous microdeletions in the MIR17HG locus had severe skeletal abnormalities [PMC9710060]. The downregulation of miRNAs encoded by MIR17HG has been observed in MB231RN-LM cells, a cellular subline of MDA-MB-231, isolated from spontaneous lung cells [PMC9954167]. MIR17HG has been found to promote colorectal cancer tumorigenesis and metastasis by sponging miR-375 to increase NF-κB/RELA expression and upregulate PD-L1 [PMC8424797].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAAGCUCUCCUCGCGGGGCGGGCCGGCCGGCCGCACCCCCGGCCUGGGGCCUCCGGUCGUAGUAAAGCGCAGGCGGGCGGGGAGGCGGGAGCAGGAGCCCGCGGCCGGCCAGCCGAAGAUGGUGGCGGCUACUCCUCCUGUCAUACACGUGGACCUAACUGCACCAGUAGCUUUUCUGAGAAUACUUGCUGAAAAGGAAGUUUUCUGGAAUGGUAUUUGCUAAGUGGAAGCCAGAAGAGGAGGAAAAUGUUUUGCCACGUGGAUGUGAAGAUUUCCUCUAAAAGGCAGACCUGUCUAACUACAAGCCAGACUUGGGUUUUCUCCUGUAGUUUGAAGACACACUGACUCCUGACAAAAUGCAGCCUGCAACUUCCUGGAGAACAACUCAGUGUCACAUUAAAGUUUAUUAUGUAUUUAAUGAUACACUGUUUAAUUGACAGUUUUGCAUAGUUUGUCUAACUUUAGAGAAUUAAGAGCCUCUCAACUGAGCAGUAAAGGUAAGGAGAGCUCAAUCUGCACAGAGCCAGUUUUUAGUGUUUGAUGGAAAUAAGAUCAUCAUGCCCACUUGAGACUUCAGAUUAUUCUUUAGCUUAGUGGUUGUAUGAGUUACAUCUUAUUAAAGUCGAAAUUAAUGUAGUUUUCUGCCUUGAUAACAUUUCAUAUGUGGUAUUAGUUUUAAAGGGUCAUUAGGAAAAUGCACAUAUUCCAUGAAUUUUAAGACCCAUAGAAAAGUUGAAGAAUGCUUAAUUUUCUUAUCCAGUAAUGUAAACACAGAGACAGAACAUUGAGAUGUGCCUAGUUCUGUAUUUACAGUUUGGUCUGGCUGUUUGAGUUCUAGCGCAUUUAAUGUUAAUAAAUAAAAUACUGCAUUUUAAAGCUGUUAAGAAAUUGUCCAGAACGAGAAUAUUGAAAUAAAAACUUCAAGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications