Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-580-3p URS000075D9A5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-580: Hsa-mir-580 is a microRNA that has been identified as one of the leading upregulated miRNAs in melanoma [PMC6820336]. It has been found to potentially modulate five out of ten hub genes, including DMRT2, MTCH1, MTERF4, NHS, and MMGT1 [PMC6820336]. Additionally, hsa-mir-580 has been associated with the pathogenesis and development of melanoma [PMC6820336]. It has been observed that rs5742714 creates a microRNA binding site for hsa-mir-580 [PMC6337782]. Hsa-mir-580 is predicted to pair with several miRNAs including hsa-miR-1208, hsa-miR-1257, hsa-miR-145, hsa-miR-198, hsa-miR-516b, hsa-mir-580, hsa-miR-587 and hsa-miR7 [PMC7545778]. The substitution of the rs5742714 G allele by the C allele may create an miRNA binding site for hsa-mir-580 in breast cancer and negatively regulate TWIST1 expression [PMC5157037].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGAGAAUGAUGAAUCAUUAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes ptr-miR-580
Publications