v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1574 (LINC01574) URS000075D983_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01574: LINC01574 is a long non-coding RNA (lncRNA) that has been studied in the context of breast cancer (BC) [PMC9348968]. In a study, the knockdown of LINC01574 was found to increase tumor cell death and decrease the level of the Ki-67 protein in subcutaneous BC tissues [PMC9348968]. This suggests that LINC01574 may play a role in promoting tumor cell survival and proliferation. Additionally, LINC01574 knockdown was found to inhibit the migration and invasion abilities of MDA-MB-231 and MDA-MB-468 BC cells [PMC9348968]. This indicates that LINC01574 may also be involved in promoting BC cell migration and invasion. Furthermore, the study showed that the inhibition of migration and invasion caused by LINC01574 knockdown could be partially attenuated by adding a miR-6745 inhibitor [PMC9348968]. This suggests that miR-6745 may interact with LINC01574 to regulate BC cell migration and invasion. Overall, these findings highlight the potential role of LINC01574 in promoting tumor cell survival, proliferation, migration, and invasion in breast cancer [PMC9348968].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUGGGGAUCUGGCCCUCUCCCGCUUGCAGGUGUGGCUGGCGUACGCGUUGGGAGCGCCUGCUUGCCCCUCCUCCGGGGGGGAAGGACUGGCCGUCGUCCCUGCCCCGGGGGUGCGGGUGCGCCGAGCCCUCGGGAGGCCUGGCUCUGGUGUGGGCUGCGGGGAGAAGGCGCGGGAAGGAAGGAAGGAGGCGAAGCGGUGCGGGAGGGAGGCGGCCGUUGCCAUGGAAGGAGCUGCAAGCCUCCCUGCAGACCGCGAGCGGAGCCCCCGCACCCCCGGGGCUGGCCCCUGGCCUCCCGCCCCAGCCCGGCCGGCGGCCCCUCCCUGCUCCGCUGUCCGCCUUGGGUACAGAAGCGGCGAGUGGCCCCUUUCCAGGAGGCCUGUUUACCAGCACGACAACGGCAAAUUAGUGCGCUUAAGAGGCAUUCGGCGUUUAUCCCGGCAAACAUGCGCAGCGUGAAGGGGGCCUGCGAGGCCUGCUCCCCGGAAUCUGCUGAAAUGGGGUCUGCUGUGCAUCUUAAUCGACUUACUUCCACCCAUCACAUUAAACGCAUUUAAUCUACUCUUGCAAAUGGCUAAUUUUGAAAAUCCGCUUAUCAGAAUUAGGUCCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications