v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 905 (LINC00905) URS000075D91B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00905: LINC00905 is a long non-coding RNA (lncRNA) that has been identified as part of a signature associated with predicting the recurrence of cervical cancer (CC) and has potential as a prognostic biomarker [PMC9523019]. It is one of the seven lncRNAs (HCG11, CASC15, HULC, LINC00173, LINC00189, LINC00905, and MIR22HG) that play a role in predicting CC recurrence [PMC9523019]. FAM95B1 is another gene that was found to be downregulated in CC cell lines along with LINC00905 [PMC8997840]. HCG11, CASC15, LINC00189, and LINC00905 have been shown to be significantly correlated with the deterioration of recurrence-free survival in cervical cancer patients [PMC8756255]. These four lncRNAs were associated with worse recurrence-free survival (RFS), while HULC, LINC00173, and MIR22HG were associated with better RFS [PMC7002755]. The levels of HCG11, CASC15, LINC00189, and LINC00905 were higher in the high-risk group for CC recurrence compared to the low-risk group [PMC7002755]. Univariate Cox regression analysis revealed that 14 lncRNAs including LINC00905 had prognostic value for CC recurrence [PMC7002755]. The biological functions of lncRNAs like LINC00189 and LINC00905 are less studied and require further exploration [PMC7002755]. The expression profiles of patients with CC from TCGA revealed seven differentially expressed lncRNAs including LINC00905 associated with RFS in CC patients [PMC9436424]. In male infertility studies as well, lncRNAs like LINC00905 have been identified as deregulated but require further research for better understanding their functions [PMC9598197].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGAAUCUCGUCAGUUAAGGACCUGGUCAGUUGGGUCCAGUCAGUGGGGGCCUGGUCAGUGGAGACCUAGGCCAUCAGUGGGUCCUGGAUAGUGAGGCCUGGUCAUUGGGGUCCUGGCACAGACCCAGGCCCAGGGGAUGCCCAAUGCUGGGAGGAGGCUCAGACAGCAGGAAGGAGAGAAGGAAGGAAGGAACUUCCGUAGUACCGAUGCCUACAAAAUUACAACACGUGGUGCUGUUUCUACUCCAUCACCAUGUUCGCUCUUUAUUUCCUAUGUAAUUCUCUAUUCAACCGGCCUCAGUUGAGCACAAAACCAUCCUUGUACCACCAUGAAUAGUUGGCCAUGGCUCUUUGAUAGCAAUUUUUGUUCUGCCGUAGAAAUUAUCCUUGAACCAGAAAAAAAAAUCCCCAAUUCAACACUCCAUUUUUGUGAAGAGCUGGUUCCGAAUUCUGGGUCACUUUUUGGAAAAAAUAUCUGUUGUGGUAAACAGUGCUGCAUCUGUGAUCUCAAGUCUCUACUGGAAUUGGAUAGAGAUGGUGAAUUUCAGCCAGAGCGCCCAAAGAACUCGUGUCCCGCGCUCCUGAACGCCAUCAGCCGCCGCACCUCCAUCUUCCCUCCUCCCACGAGUCUCCUGCUCCCCGUGACUCUGGCCUCCUCGCAGUGUUGCUGGGCCACGUCAGGAAGUGCUGGAGGACGUGGCAUUGCACCAACACCAGGCGGCCAGCCGUGUGGCUCAUCCCGCAAAUCAGGCUCUUCCUGUGCAUGGAGAUGGAGUCCCUCUGGAGGCAGCCCGUGGCCCUGUUCUCGGGCAGGUGGAGCAUGGAGACGACUGGGAACUUCACUAGACACGCAUCCAGCCGGUUCAAGGGCUUGUCGCGCCGUGCACCAGCUUGCAGGAGAAAGCCCAACGCCUCGCCAAGCACGAAGGCCUCCCUUCCCGACUUGAUGAAGGCAGAGUAGCGGUUGAGGUUGCGGCUCACAGUGACCGAGCUCCUGCCCACGUGGGGACCCAGGGAGCCGUCGAGCUCCAGCCCAGGCUUGGACCUGAAGAAGCUGGCAACCCGCGAACGCCAACAGGCACAGUCGAAAAAAGCAAAAGAAAAAUCCCAAACAAAAUCCUGUUCUCCCUAGCCAAAGGACCAGGAGAGGGGGCAGCCCAGCAAGACAAAACACAUUUACACAAUUCUGGCUAACCUCAGCCAGUCCUUGGCCGUGAGUUCGUUUUUCUGCCACCUCACUUUGGGGCUGGGCUGGUUCUCCACCCUCGCAGGGUGCGUUUCUCAAUCCAGACGCUGGGGGGCGCUAGUACCUCGCGAGCUCCGCGAGGAUCAUUCCCGGGACGCCGCGGAGUCACCUCCCCUCCUAGGGACCCAGAGCUUCCCAGGGCCGCGCCUGUAGGUUUUCCAGAGGUCCCCGAAAACGUUAAAGACCUGGAAGGAAAAAAAAACUGUAAAACCACACACUUUGAUAUUUGACAACGUAAAAGCAAGGCUGCAAAAUCAAAAUCAAUGAACGCUUGAAGGAAAUGUCUACUUAGCUAGACAUAGUGCCACCUGGAUUCACUGUUGGCUCCAGAAUCCCCCCCACGGUGUCAUCACGUUGGAAAGUUUUUGUGGGUUAGAUGUUCUCUGUUGGCAAGAAUGCCUGUACAUGCCCAAGAAGCAUAUGAGUUUAAUGGGACCCCAAUAACUUCAAAAGCAAAAAGAUAACGAUCCUUUCUACUUUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications