Homo sapiens (human) microRNA 320b-1 (ENSG00000211543.2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA 320b-1 (ENSG00000211543.2) URS000075D8C5_9606

79 nucleotides
4 databases (ENA, Ensembl, GeneCards, MalaCards)
Found in 4 other species
1 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AAUUAAUCCCUCUCUUUCUAGUUCUUCCUAGAGUGAGGAAAAGCUGGGUUGAGAGGGCAAACAAAUUAACUAAUUAAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Gorilla gorilla gorilla microRNA 320b-1 (ENSGGOG00000034210.2)
Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 320b-1 (ENSNLEG00000020668.2)
Pan paniscus (bonobo) microRNA 320b-1 (ENSPPAG00000006793.1)
Pan troglodytes ptr-mir-320b-1 (ENSPTRG00000032208.2)

2D structure

Publications