Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-18b precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-18b precursor URS000075D7DB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR18B: MIR18B is a microRNA that has been implicated in various diseases and biological processes. It is part of a cluster of miRNAs, including miR17, miR20a, miR20b, miR18a, and miR106a, which have been extensively studied in the context of cancer [PMC3544584]. In polycystic ovary syndrome (PCOS), MIR18B has been found to be upregulated in the follicular fluid of PCOS patients compared to normal women [PMC6956659]. Additionally, MIR18B has been reported to repress MDM2 and activate p53 [PMC9791775]. In cutaneous squamous cell carcinoma (CSCC), MIR18B is one of the upregulated miRNAs in CSCC samples [PMC3341860]. Other studies have shown that MIR18B is involved in cell cycle regulation and inflammation-associated conditions [PMC9555085] [PMC7432402]. In breast cancer patients undergoing neoadjuvant therapy (NAT), high expression of MIR18B has been associated with response to treatment [PMC8537499]. Furthermore, dysregulation of MIR18B expression has been proposed as a prognostic marker for mantle cell lymphoma (MCL) and nasopharyngeal carcinoma (NPC) patients [PMC6183594] [PMC6368411]. Additionally, it has been suggested that MIR18B may play a role in the positive regulation of Orai3 expression through its interaction with other microRNAs such as miR18a [PMC9817886].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGUUAAGGUGCAUCUAGUGCAGUUAGUGAAGCAGCUUAGAAUCUACUGCCCUAAAUGCCCCUUCUGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Macaca mulatta microRNA mml-mir-18b precursor
  2. Pan troglodytes miRNA
  3. Pongo abelii miRNA
  4. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-18b precursor
2D structure Publications