Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ZNF649 antisense RNA 1 (ZNF649-AS1) URS000075D7B0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ZNF649-AS1: ZNF649-AS1 is a long non-coding RNA (lncRNA) that has been implicated in various aspects of breast cancer. It has been found to regulate trastuzumab resistance in HER-2+ breast cancer cells through autophagy, along with another lncRNA called AGAAP2-AS1 [PMC9254371]. Down-regulation of ZNF649-AS1 can inhibit autophagy and reverse trastuzumab resistance in breast cancer with positive HER-2 [PMC9254371]. ZNF649-AS1 is associated with PTBP1 protein induced by H3K27ac modification, and this association promotes the transcriptional activity of the ATG5 gene, which is involved in autophagy [PMC9254371]. It has been reported that ZNF649-AS1 activates the transcription of ATG5 by recruiting PTBP1, indicating its stimulative effect on autophagy [PMC8811066]. The binding of ZNF649-AS1 to PTBP1 enhances the stability of ATG5 mRNA and promotes autophagy in breast cancer cells [PMC9868890]. In clinical treatment, upregulation of ZNF649-AS1 gene induced by H3K27ac modification may lead to autophagy and trastuzumab resistance through its binding to PTBP1 and promotion of ATG5 transcription [PMC10006230]. ZNF649-AS1 is also identified as one of the screened biomarkers for SPTB (spontaneous preterm birth) along with other genes such as FADS2, PCDHGB5, and MFSD4A [PMC7689379]. Knockdown of ZNF649-AS1 can reverse trastuzumab resistance by modulating ATG5 expression [PMC8473733]. Furthermore, in lung adenocarcinoma, ZNF649-AS1 is one of the independent predictors of tumor relapse, along with other lncRNAs such as LINC01819 and HNF4A-AS1 [PMC8773641].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAUGCAAUAUGUCUGCGCCCAGGGGACGCUUGCUGGGAGCAGCCAUUUUCAACCCUACUGCCGUAGAGCAGGCGGAGUCCCUCUUUUCGCGCCUUAAGACAGAAACACAAAAUGAUCCUCUGACAAGUGAUGAAGAAGAAUGGGAAGAUGUGAAAAUCCAAGCAAGAAGAACUUAGGGGAAGCAACUCAACAUCUAAGAAGAAAUGAAUAGGGAUCAGUUCCAAGAAGAGAUAAAGGGGAAAUACCCAAGAACUGGGAUGCUUCGUCUUUGGUUUCUUCUGGAUCCUCCCUAAAUUUUGGCUAAGAAAUCUGAGUCUCCAUUUAAGAGUGUUCCCAGAAAUGAUGACAUCCACAUCCAGGAACCUCCUCCUUCCUUCAUUUGAACUCUCUUGCUUCUGGGGAGCCAGGACCUAUGGAGUAAAAAUCAAGUUCAUUUGGUGACACAUUCCCUCCGGGCCCAGAUGCUGUCUCUGCUGCUGUAAACUCUCCUGCAGUCAAGGCCAAGCAAUAUAUCUAAGCAUCCCUUUGUCAGGUGUCCCCAAGUCUUUACAUCCCAGGGCAAUAAAACAACACUCUGAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications