Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-501 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-501 precursor URS000075D7AB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR501: MIR501 is a microRNA that has been found to be elevated in plasma in cases of community-acquired pneumonia (CAP), along with other miRNAs such as MIR100, MIR99A, MIR483, MIR141, MIR378C, and MIR193B [PMC8358855]. In wheat, sequencing efforts have identified 58 wheat miRNAs, including 23 novel ones such as MIR501 [PMC5360763]. In a study on schizophrenia, two single-nucleotide polymorphisms upstream of MIR501 and two ultrarare protein-altering variants in its host gene CLCN5 were found to be associated with the disorder [PMC9390987]. The function of miR-501-3p in schizophrenia was investigated using a mouse model with the knockout of the MIR501 gene [PMC9390987]. The human counterpart of mouse MIR501 is located on chromosome Xp11.23 within the CLCN5 gene [PMC9390987]. MiR-501-3p has been shown to be highly expressed in multiple tissues and specific neuronal types [PMC9390987]. The role of miR-501-3p in the pathophysiology of schizophrenia is still being investigated [PMC9390987]. MiR-501 is part of a cluster that includes other microRNAs such as miR532 and miR362 [PMC4241533]. MiR500A is also part of this cluster and has been associated with different cancer types [PMC8253104]. In addition to its role in schizophrenia, miR-501 has also been implicated in synaptic plasticity regulation and periodontitis pathogenesis [PMC4783348] [PMC9314012].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUCUUCCUCUCUAAUCCUUUGUCCCUGGGUGAGAGUGCUUUCUGAAUGCAAUGCACCCGGGCAAGGAUUCUGAGAGGGUGAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

2D structure Publications