Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-520a precursor URS000075D78D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR520A: MIR520A is a miRNA gene that is associated with decreased expression in classical Hodgkin lymphoma (HL) [PMC6183594]. The TCGA miRNA-seq dataset of liver hepatocellular carcinoma (HCC) was used to analyze the cumulative expression of all 46 C19MC miRNA genes, including MIR520A [PMC7378193]. MIR520A, along with other non-coding RNAs such as miR-20a-5p and miR-143-3p, has the potential to regulate the gene RRM2 [PMC9414017]. In breast invasive carcinoma, the cumulative expression of all 46 C19MC miRNA genes, including MIR520A, was analyzed using a miRNASeq dataset [PMC6193703]. MIR520A-3p is a mature miRNA produced from the MIR520A gene located on human chromosome 19q13.42 [PMC6699151]. The circRNA "chr19:53,687,886-53,694,145" overlaps with both MIR1283-1 and MIR520A genes in RNA-seq samples [PMC8113443]. Overall, various miRNAs including MIR520A have potential as biomarkers and therapeutic targets in malignant tumors due to their important roles in tumor development and progression [13].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCAGGCUGUGACCCUCCAGAGGGAAGUACUUUCUGUUGUCUGAGAGAAAAGAAAGUGCUUCCCUUUGGACUGUUUCGGUUUGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications