Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) OVCH1 antisense RNA 1 (OVCH1-AS1) URS000075D789_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

OVCH1-AS1: OVCH1-AS1 is a differentially expressed long non-coding RNA (DElncRNA) that has been found to be upregulated in Crohn's disease (CD) compared to controls in ileum and rectum samples [PMC8323253]. It is one of the top three DElncRNAs that cover the most differentially expressed mRNAs [PMC7984875]. OVCH1-AS1 has also been observed to be upregulated in high-risk kidney renal clear cell carcinoma (KIRC) patients [PMC9761138]. It is transcribed from the antisense strand of the OVCH1 gene and may have an opposite effect [PMC9761138]. In KIRC, OVCH1-AS1, along with other lncRNAs such as SBF2-AS1, AC002451.1, CDK6-AS1, LINC02154, AC103706.1, and AC034236.3 have been identified as prognosis-related lncRNAs that can be used to construct a risk signature for estimating patient prognosis [PMC9761138]. Lower expression of OVCH1-AS1 has been associated with a less favorable survival outcome in KIRC patients [PMC9761138]. Additionally, OVCH1-AS1 has been found to be upregulated in WF4-WF6 and downregulated in WF6-WF2 samples [PMC9690332]. Overall, these findings highlight the potential role of OVCH1-AS as a biomarker for disease diagnosis and prognosis.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGAGAGCGCGGAGAGACGCAGAACGCAGCCAGCUCCUCCAGGGCCCUCCAGGCCCUCCGGACCCGGGCCGGCGGGUGAACUGGGGGGCCCCGGGACAGGCCGAGGCCUCUGCCCUGCAGAUACCGGAGGCCUCUGCUGUGGCUGCCCACUGGCUGUGCCCAGGCCUUGAAGCCGCAGCGAACCUCUCUUUCCCACCCCACCUGGAUGACUGAUGGCGGCGGCUGCGUCUCCCCGACGGGACCCCGCCGGCCGCCGCGUCUCCCGACCCAAGCCUGCCGGGCCUCGACGAAACCCCCGCAGAGUCGCUGGGACGCAGCGCCUUUGGGCGGCGCCGGGCGUGGUGGGCCGGAAAGUAUGGCGGCCGCUUGAACGCCGCGCGGCGGAGGCCAUUAAGGCGUGGAGGGCCCGGGAAGGCGGCCUAGGGACGCAAGCAGGCUCGGCCACCUCUUUAGGCCACGGAGCCGCGCAGAUCCGGUUCCCGGGUGACCACUCUGUCGCCAUUGGGCGAGACCGACCUAGUCCUGACGACAACGGACAAAGGCCUUCAGGGGCCUGGAAGGGAUAUGAUAUUGAAGCACGUGACAAGUUGGUGAUUUCAGCAAUGGUUUCUCCUGUCUAUAGAAACUCUUCAGCAGAUGGCAAUUUUCCACCUUCCUGUAUAAAACCAGAAUCCUCUCACCUGGCAGAAAUCUUUCUCUCCAGAUGCUGCAAAGCCAGCACAGAUCAUCUUCUCUGUGAUCCCUCCUGGAUGGGCAGAAUAAAAGAAGAGGGGCUGAAGCGGAUGCUGCUUGAUAUCAUUUACAUGACCUAUUUUCAAAAAUAACAACUGGCAUUAAUGUUUAUGCAACAAAAAUAUGCUUACCUGCACUGAUGCUUCCCCAUCCGGUCACAGCACAGAUCUCCGAGGAAAAUAGAGGCUCUGCGCUGUGUGGGAGACAUACUGGCCUCACCACCGAGUUGUACUCCAGAGGAGAGCUUAGUUGUAUUAGGGCAAUGUCAGAGUCAUAACUUAGUGUGUUAAAGUCUUCAUGCACUAUUAUGUGUUUGGCCCUUCUCACCUGUAUCGGUGGCAAGUAAGCAAAUUACAACGUAAGAAAGUCAAAGAAUCCAGCAACUUCCUUGUUGAUGGUCCAAAAUAAUCCUAAAUUUCUGCACUUACAUACAUAAACAAUGCAGAAGACUUUCUAUUAAAUUUAAAAGAGCAAUAUUGGUUUACAAUUUGCAGGGGGCUAUGAACCACCUUCUGGAUAAAGGUGGUGCUGGAGAAAUAAAGCUUUGAAAACCUGAAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications