Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1324 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1324 precursor URS000075D73A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1324: Hsa-mir-1324 is a miRNA gene that has been the subject of validation studies, but the results have been inconclusive due to the presence of multiple bands in the gel [PMC4064319]. There are two main types of overmutated miRNA genes, one showing a distribution of mutations across various cancer types, including hsa-mir-1324 [PMC7648123]. Hsa-mir-1324 is the most commonly mutated gene, with a high frequency of mutations in Pan-Cancer [PMC7648123]. However, further analysis of miR-1324 alterations was not pursued due to doubts about their credibility as somatic mutations [PMC7648123]. Hsa-mir-1324 has also been found to have high frequency and a similar pattern of mutations in diffuse large B-cell lymphoma and Hodgkin lymphoma cell lines [PMC7648123]. The genomic location of hsa-mir-1324 is embedded in a large segmentally duplicated region that is highly similar to other sequences in the genome and likely variable in copy number [PMC7648123]. The mutations observed in hsa-mir-1324 are likely artifacts of sequencing procedures and computational analyses [PMC7648123]. The substitutions differentiating hsa-mir-1324 from its paralog counterparts correspond with the identified mutations, further supporting their artifact nature [PMC7648123]. References: [PMC4064319] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4064319/ [PMC7648123] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7648123/ [PMC3087710] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3087710/ [PM4503774] - https://www.ncbi.nlm.nih.gov/pmc/articles/PM4503774/ [PM5579249] - https://www.ncbi.nlm.nih.gov/pmc/articles/PM5579249/ [PMC8973950] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8973950/ [PMC5759858] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5759858/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUGAAGAGGUGCAUGAAGCCUGGUCCUGCCCUCACUGGGAACCCCCUUCCCUCUGGGUACCAGACAGAAUUCUAUGCACUUUCCUGGAGGCUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

2D structure Publications