v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) CATIP antisense RNA 1 (CATIP-AS1) URS000075D700_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

CATIP-AS1: CATIP-AS1 is a type of long non-coding RNA (lncRNA) that has been studied in the context of thyroid cancer (THCA) [PMC8973971]. In a study, the expression level of miR-515-5p, CATIP-AS1, and Smad4 was determined using the 2−ΔΔCt method, with GAPDH and U6 serving as endogenous controls [PMC8973971]. To investigate the in vivo function of CATIP-AS1, researchers utilized a xenograft nude mouse model with BCPAP cells transfected with pcDNA3.1-CATIP-AS1 [PMC8973971]. The study aimed to evaluate the functional effect of overexpressed CATIP-AS1 in THCA cell lines [PMC8973971].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGGAGGAGCCCAAGGCCGGUGACGACGGACGCCACGGGUCGAAGGGGCCGAAGAACUCGGCGGCGAAGGUGACCACGUCCUCCGGCUGGCGCAGCAGCAGGAAGAGCAGGAAGUCGGAGAUGAGCGCGUGGGCUUCGGGGUGCUGCCGCAGAUAGCUGGCGUGGCCGAGCCGGAGCUCCUCCUGGCAGGGGACAGAGCCCGAGCCUCAGCCGGACGGGACCCCCGCGCCCCAGGAGCCCCCAGCCGCUCGCUCCAAGGAGAGCUAAGGGGCGCUGGAGCCUUCUAGCCCCUACGGGUGUGCAUUUCAAUCAGGUGCCUGGAGUGCAACACAACAUGUGAGAGUGAGAAUCUUCCCAGACCGCCUGCUAUGGACUGAAUUGUCUCUCUAACCCCCAGUGUGGUGGUAUUUGGAGAAAGGCCAUGUGAGGACACAUUGAGAAGGCACUUGUCUGCAAGCUAGGAAGACAGCCCUCACCAGAAACCAACCCUGAUGGCACCAUGAUCUUGGACUUCCUGCCUUCCAGCAAAUAUAUUUCUCUUGAAGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications