Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-591 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-591 precursor URS000075D670_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-591: Hsa-mir-591 is a microRNA that has been implicated in various cardiovascular diseases, including atrial fibrillation, coronary artery disease, and idiopathic dilated cardiomyopathy [13,42,43]. It has also been found to be associated with heart disease and ischemia [44,45]. In the context of acute myocardial infarction (AMI), the expression of hsa-mir-591 is regulated along with other inflammatory and oxidative factors such as TLR2, NFKBIA, and ADM [PMC8863347]. Nilotinib treatment has been shown to affect the expression of hsa-mir-591 as well as other genes involved in the ubiquitination/deubiquitination cycle and autophagy-ubiquitination pathway [1,31]. In a study on glioblastoma multiforme (GBM), hsa-mir-591 was found to be significantly deregulated and showed a new association with GBM [PMC8151942]. Additionally, hsa-mir-591 was among the top 10 down-regulated DEmiRNAs in a different study [PMC9814319]. Overall, hsa-mir-591 appears to play a role in various diseases and biological processes through its regulation of gene expression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUUAUCAAUGAGGUAGACCAUGGGUUCUCAUUGUAAUAGUGUAGAAUGUUGGUUAACUGUGGACUCCCUGGCUCUGUCUCAAAUCUACUGAUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications