Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) C1QTNF1 antisense RNA 1 (C1QTNF1-AS1) URS000075D5C6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

C1QTNF1-AS1: C1QTNF1-AS1 is a long non-coding RNA (lncRNA) that has been studied in relation to miR-221-3p. The dual-luciferase assay demonstrated that miR-221-3p can bind to the 3'-UTR seed sequence of C1QTNF1-AS1, as the addition of miR-221-3p mimics inhibited the activity of luciferase in the wild-type group [PMC6745033]. The study also used specific primers for linc00899 and C1QTNF1-AS1, targeting exons 2–4 and 1–2, respectively [PMC7160116]. C1QTNF1-AS1 is a lncRNA that has been implicated in various biological processes and diseases. It has been shown to interact with miRNAs, such as miR-221-3p, which can bind to its 3'-UTR seed sequence [PMC6745033]. The dual-luciferase assay provided evidence for this interaction by demonstrating that the addition of miR-221 mimics inhibited luciferase activity in the wild-type group [PMC6745033]. In addition to its interaction with miRNAs, specific primers were used throughout the study for linc00899 and C1QTNF1-AS targeting exons 2–4 and 1–2, respectively [PMC7160116]. These primers were used consistently unless otherwise indicated. This indicates that these specific regions of linc00899 and CINQTNF11 were of particular interest in the study [PMC7160116]. In summary, CINQTNF11 is a lncRNA that interacts with miRNAs such as miR221. This interaction was demonstrated through a dual-luciferase assay, which showed that miR-221-3p can bind to the 3'-UTR seed sequence of C1QTNF1-AS1. The study also used specific primers for linc00899 and C1QTNF1-AS, targeting specific exons, to further investigate their roles [PMC6745033] [PMC7160116].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAGAACUAGAGGCUGCAGCGGCAGCAGUUGGAGCAUCUCACUGCGGGGCUCGGGAAGGAGGAAAGGAGUGAGCAUGUCCUGCUCCUGCAUGUCCCUGCUUAAGCUCAGGACUGGCCCUUCCAGGCCAAGGACCCCAGCAUAGACCCCAGGACAGGGCCCCAAGGAUCCCUGGCUCAUGAGAGCGGCUUGCUGGGCUGCCCCAAGAGAGCCUGAAGGAAACACAUUGUUGAGCUGAGCUGACGUCGCUGUUUCUUCCAGACUGCUCUCUAAAGUGGGCAGGGUAGCGACCGGCCGGCUCCGAUGGUGACGUCCCACUGCCAAGGGGUGGGAGUGGGGAGAGUCUCCACAGAGCUUCGGAGAAGCUGCUAAGAUGGAAAAGUGGAAACUUGGCAGACAGAUCCAGCCUCCCUGGCCACUGGCCCAUGCUCGUGGCUCCUGGAUGGCGCUGCCACGUUCUGAGCAGCUUGGGACAGGUGGAGAUCAGGACUGGCAGCUGCAAGGACACACCAGGUGAAUAGGUUUCUUUAUGGUCCUCACACCUGCAGAAAACCAGGAGGAGCCACAGAAACUAAAGAGAAUUUCCAAAAGGAGUCUAUGGUGAAGUCUCUGAGGAUGCAAAGAAGACAAGGAGAAUGAAAAUCCAAUGAAAGCCUGAUUGUAUUUGUUGACCUUAAGGAAAGUGAUUUUAUGGUACAGCCUCUCUGGAAGGGAGGGUGUGUUCGCUCACAGAAUGCAAAUACCCUUUGACCCCCUAAUCUUUCUUCUAGGAGUUUCUCCUACAGAUAAACUUAGAAGGGUGCUCAAAUAAGUAAGUUCAAGGAUAUCCUCUGAAGCAUUGCCGUAGUAUAAAAAAAGCACAGAUACCCUCAAAGGACAUCAUUAGGGGCCUGGUAAAAUAAAUUCCACACAGUGGAACACCGUGUAGCUCUUUAGAGAAUAAACAGCUCUCUAUAUGUGAUCUGGAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications