Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4749 precursor URS000075D57A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4749: MIR4749 is a type of microRNA that was studied in the context of its interaction with human serum albumin (HSA). The researchers selected complexes with a DDA (donor-donor acceptor) distance falling in the 3.9–4.9 nm interval, taking into account the calculated DDA distance in the 3.8–4.8 nm interval and an estimated contribution of 0.1 nm from the dye attached to the 5′ end of MIR4749 [PMC8835948]. The interaction between HSA and MIR4749 was initially investigated using fluorescence spectroscopy [PMC8835948].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUGCGGGGACAGGCCAGGGCAUCUAGGCUGUGCACAGUGACGCCCCUCCUGCCCCCACAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications