Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-33b precursor URS000075D54F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR33B: MIR33B is a small long-coding RNA that is constitutively under-expressed in multiple myeloma (MM) patients [PMC5721125]. Overexpression of MIR33B has been shown to inhibit tumor growth and increase survival in a human MM xenograft mice model [PMC5721125]. Under baseline conditions, oxLDL has been found to decrease the levels of MIR33B [PMC4945056]. However, pitavastatin has been shown to prevent the suppression of MIR33B by oxLDL [PMC4945056]. Silencing MIR33B has been found to reverse cordycepin-mediated suppression of invasive and migratory phenotypes in vitro and melanoma metastasis in vivo [PMC4496401]. Ixazomib treatment has been shown to induce upregulation of MIR33B in MM cells, leading to apoptosis by blocking the proto-oncogene PIM-1 [PMC7236745]. MIR33B is located in intron 17 of the SREBF-1 gene on chromosome 17 [PMC3639327]. Rodents lack the MIR33B gene in the SREBF-1 gene [PMC3639327]. Plasma levels of miR-33a and MIR33B have been found to be upregulated in familial hypercholesterolaemic children and positively correlated with LDL-C, LDL-C/HDL-C ratio, apolipoprotein B, CRP, and glycaemia [PMC5113745]. The transfer of MIR33B from MSCs to astrocytes through exosome-downregulated connected tissue growth factor expression can reduce glial scarring and promote neurite growth [PMC6038041]. Mentioned studies: [PMC5721125] - Study on microRNA profiling of MM cells treated with ixazomib [PMC4945056] - Study on the effect of oxLDL on miRNA levels [PMC4496401] - Study on the role of MIR33B in cordycepin-mediated suppression [PMC7236745] - Study on the effect of ixazomib treatment on MIR33B expression in MM cells [PMC3639327] - Study on the location of MIR33B in the SREBF-1 gene [PMC5113745] - Study on plasma levels of miR-33a and MIR33B in familial hypercholesterolaemic children [PMC6038041] - Study on the transfer of MIR33B from MSCs to astrocytes

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGGGCGGCCCCGCGGUGCAUUGCUGUUGCAUUGCACGUGUGUGAGGCGGGUGCAGUGCCUCGGCAGUGCAGCCCGGAGCCGGCCCCUGGCACCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Publications