Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) NRG1 intronic transcript 1 (NRG1-IT1) URS000075D4D3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

NRG1-IT1: NRG1-IT1 is a long non-coding RNA (lncRNA) that has been found to be highly expressed in Wilms tumor (WT) patients, and its high expression is associated with high survival rates [PMC6915924]. In a study on WT, 16 differentially expressed lncRNAs, including NRG1-IT1, were significantly associated with overall survival rates [PMC6915924]. However, there is limited knowledge about the regulatory role of NRG1-IT1 in cancer [PMC6915924]. In another study on osteosarcoma (OS), NRG1-IT1 was found to be downregulated in tumor samples compared to normal bone tissues [PMC9680297]. Additionally, it was discovered that NRG1-IT1 encodes micropeptides along with FGF14-IT1 and ANKRD44-IT1 [PMC9680297]. However, there is a lack of literature on the role of NRG1-IT1 and other lncRNAs in tumorigenesis [PMC9680297]. Furthermore, the subcellular localization analysis showed that NRG1-ITI is located in the cytoplasm [PMC9680297]. Overall, these findings suggest that NRGI-ITI may play a role in tumor development and survival outcomes. However, further research is needed to fully understand its function and mechanism of action.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGCAAUCUCUAUGGUAACCACAUUUCCCAGUUGACUACUACCGGUAAUAAAAUCAAAUGGAUUCAGUGCUCACAACUCUUCAGUCUUUGGGCUACUUUCCAUUCUUGAAUUUUUAGCUGAAUUCAUCUCUUUGGCUGGAUUUUGUGAAUCGGGCAGCCAUUAGAACCAAAACAGUUCUGAGGAGCUCCCAGGCUGCAAUGUGGUGCGAAAUGUUUUAUGGACAGAAAAUGGAAAUGAGGUGCAGAAAUUGGAGGCUAAGAAUAAACUUGAAGACAAAGAGUAGAUUUUGGCCAGACACUGAUGCUAAAGUCACCCCGAUGCUGUCUUUGCUUCUAAGAUGAAAUUUCAGUCUUUAUUCAAGAUCAAGUGCAACUGUCUCUUUGAGGAAAGUCCUUUGACCGCCAUUUCUCCCCUUCAGAAGGCAAACACCUGGGGGAGAAGAUCUGCUUAAGGACCUGGUAACUGACAAAGAAUGGAAUGGGAGCGAGAACCGCCUAGCCAUCCCUUCUCCUUGCACAGUCAUGAAACAAAAGUUGAAAAGGAGCCUGGUUUUACUUGACCAGUCAUAAAUUACCAUAAAAUAAAAUGAGAUAUUAGGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications