Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-889 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-889 precursor URS000075D4A4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR889: MIR889 is a miRNA that belongs to the miR655 miRNA cluster, which contains a total of 20 miRNAs [PMC7465874]. Nine of these miRNAs, including MIR889, have available expression data [PMC7465874]. In the context of HCV and chronic HCV complications, several upregulated miRNAs have been identified, including MIR889 [PMC9495750]. The expression data for the miR655 cluster reveals that it contains 16 miRNAs [PMC10148110]. Cancer cells have mechanisms to evade immune surveillance and tumor cell-derived extracellular vesicles (EVs) play a role in transmitting immune-suppressive messages in the tumor microenvironment [PMC10114864]. EV-incorporated RNAs can help cancer cells evade immune responses and convey death signals to immune cells [PMC10114864]. In colorectal cancer, EV-miR203 is involved in cellular immunosuppression by activating M2-tumor-associated macrophages [PMC10114864]. Additionally, MIR889 triggers the downregulation of immune infiltration in colorectal cancer [PMC10114864]. In a study on dogs, several highly differentially expressed (DE) miRNAs were identified, including MIR889 [PMC8376273]. Overall, MIR889 is a member of the miR655 cluster and has been implicated in various aspects of cancer biology and immunosuppression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGCUUAAAGAAUGGCUGUCCGUAGUAUGGUCUCUAUAUUUAUGAUGAUUAAUAUCGGACAACCAUUGUUUUAGUAUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

2D structure Publications