v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 844 (LINC00844) URS000075D3C8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00844: To investigate the biological role of LINC00844 in hepatocellular carcinoma (HCC), LINC00844 expression was induced in HCC cells, specifically HepG2 and HCCLM9 cells [PMC6993750]. In a study aiming to construct a prognostic ferroptosis-related lncRNA signature (FRLS), 15 ferroptosis-related lncRNAs were identified, including SNAI3-AS1, GDNF-AS1, WDFY3-AS2, CPB2-AS1, WAC-AS1, SLC25A21-AS1, ARHGEF26-AS1, LINC00641, LINC00844, MIR155HG, MIR22HG, PVT1, SNHG18, PAXIP1-AS2, and SBF2-AS1 [PMC8170051]. Additionally, LINC00844 has been found to act as a competing endogenous RNA (ceRNA) for miR-785-5p and regulate the expression of pregnane X receptor (PXR) and drug-metabolizing enzyme and transporter (DMET) in HepaRG cells and primary human hepatocytes (PHHs) [PMC7692647].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUGAGCCAUGCCAAUGUGGUUUGGCUGGACUGUGAGUGCUUGAUGCAGUCUGAUAGGAGGAUGGGGGUGGCGCAGAGAACAUUGAAAUCAGAAAGGAUUCUGCUCUGUAGAGACAAAGGAAACACAGAGACAUAGACAUGGAUCUGGGAAAUACACCUUUUGCUACUCGUUCAGUUUUAGCAAGGAGGUUUCUUGCAUGGCUAAGCAAAACUUAAACUUCCUCUGAGAAUUACAGGAAUUACAGGACCUGACAAAGCUAUGAAGAUUAAAACCUAUAGGAAGAAAAUCUGAACCAGAAACAGUAUGGCAGAAUUGGGAUCUGACUCACAGAGGGAAGAACUUAUAAUUCUUCACAGGUCACAUAGAAGCAUGAGAAUUUGGGUUCAAGCAAGUAAAUUCUAAAUCAGAAUCCAUACAUAAAGUGUUUGCAAUGUCCAGUUAUAUCUCCAUGAUAUUUUCUUUGUGGAAGUUGAUUGUUCUUCCUUACAAUAAAUUGCUUGAAUUGUCUGUCUAUUCAUUUAGCUAUUUCUUUUCUUGUCUUUGCGAUAUUUUUUUUUGUAAGUAAAAAAUUUUCAGACUAAAUAACAGGGUGUAAUUUUUUGCUUUGUUUCUCCUAAGUUUUGUCUUGUUUAUGACAUUAAUAAUUUUCUAAAAUCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications