Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-548k precursor URS000075D3AD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR548K: MIR548K is a microRNA that has been shown to enhance cell proliferation in esophageal squamous cell carcinoma (ESCC) cell lines [PMC7137242]. It is located within the broader region of gain on chromosome 11q13, which is amplified in ESCC [PMC7137242]. In a South African cohort, 12 out of 51 cases had a broader region of gain on chromosome 11q13.3, which included MIR548K as well as other known oncogenes [PMC7137242]. MIR548K has been characterized as a novel oncogene that enhances malignant phenotypes of ESCC cells [PMC5294420]. Higher copy numbers of MIR548K have been found in sensitive cell lines to the drug PD-0325901 [PMC5094973]. Targeting MIR548K may be relevant for chemoprevention of tumors within the same cancerization field [PMC5094973]. Depletion of MIR548K has been shown to suppress cellular growth and mobility, although its targets have not been reported [PMC5094973]. Amplification and copy number alterations of MIR548K have been associated with lymphatic metastasis and poor survival outcomes in ESCC patients [PMC6103855]. The most frequent alteration genes associated with lymph node metastasis were MIR548K, FADD, PPFIA1, CTTN, and CDKN2A, all located within the 11q13.3 amplicon [PMC6103855]. In conclusion, MIR548K is an oncogenic microRNA that plays a role in ESCC progression and may be a potential therapeutic target for this disease.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUUUCUCAAGUAUUGCUGUUAGGUUGGUGCAAAAGUACUUGCGGAUUUUGCUUUACUUUUAAUGGCAAAAACCGCAAUUAUUUUUGCUUCAACCUAAUAUGAUGCAAAAUUGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications