Homo sapiens (human) microRNA hsa-mir-3923 precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-3923 precursor URS000075D365_9606

83 nucleotides
6 databases (Ensembl, GeneCards, HGNC, miRBase, RefSeq, Rfam)
Found in 0 other species
53 publications
1. transcript
2. pre-miRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3923: Hsa-mir-3923, a type of microRNA, has been found to be closely associated with cancer prognosis [PMC7070044]. The results of Cox analysis have revealed that hsa-mir-3923 has an independent prognostic effect on the overall survival (OS) of patients [PMC7070044]. This suggests that hsa-mir-3923 could potentially serve as a biomarker to monitor gastric cancer (GC) [PMC7070044].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GGUAGAGUGAGCUCUAAUCCAAUAUUACUAGCUUCUUUAUAAGAAGAGGAAACUAGUAAUGUUGGAUUAGGGCUCACUCUACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications